ID: 946699804

View in Genome Browser
Species Human (GRCh38)
Location 2:222401102-222401124
Sequence CTTTTTGCACAAAGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946699799_946699804 27 Left 946699799 2:222401052-222401074 CCTATAAAATTATCAGGAAGGCC No data
Right 946699804 2:222401102-222401124 CTTTTTGCACAAAGTGAGGAAGG No data
946699802_946699804 6 Left 946699802 2:222401073-222401095 CCAACATTATGTGCTGGACTGGT No data
Right 946699804 2:222401102-222401124 CTTTTTGCACAAAGTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946699804 Original CRISPR CTTTTTGCACAAAGTGAGGA AGG Intergenic
No off target data available for this crispr