ID: 946701301

View in Genome Browser
Species Human (GRCh38)
Location 2:222417022-222417044
Sequence CTCATTCACCACTAGAAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946701301_946701305 12 Left 946701301 2:222417022-222417044 CCTAACTTCTAGTGGTGAATGAG No data
Right 946701305 2:222417057-222417079 CCCATAACTACTTTTCCTGCAGG No data
946701301_946701307 15 Left 946701301 2:222417022-222417044 CCTAACTTCTAGTGGTGAATGAG No data
Right 946701307 2:222417060-222417082 ATAACTACTTTTCCTGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946701301 Original CRISPR CTCATTCACCACTAGAAGTT AGG (reversed) Intergenic
No off target data available for this crispr