ID: 946702086

View in Genome Browser
Species Human (GRCh38)
Location 2:222424430-222424452
Sequence CCGGGTCCTAGCGCCCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 148}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946702086_946702097 5 Left 946702086 2:222424430-222424452 CCTGGGCGGGCGCTAGGACCCGG 0: 1
1: 0
2: 2
3: 11
4: 148
Right 946702097 2:222424458-222424480 GCACCTGTTGGCTGGGCCCGGGG 0: 1
1: 0
2: 2
3: 19
4: 160
946702086_946702099 19 Left 946702086 2:222424430-222424452 CCTGGGCGGGCGCTAGGACCCGG 0: 1
1: 0
2: 2
3: 11
4: 148
Right 946702099 2:222424472-222424494 GGCCCGGGGCCCCGCCCGCCCGG 0: 1
1: 0
2: 4
3: 90
4: 606
946702086_946702090 -7 Left 946702086 2:222424430-222424452 CCTGGGCGGGCGCTAGGACCCGG 0: 1
1: 0
2: 2
3: 11
4: 148
Right 946702090 2:222424446-222424468 GACCCGGGCGGCGCACCTGTTGG 0: 1
1: 0
2: 0
3: 3
4: 56
946702086_946702105 30 Left 946702086 2:222424430-222424452 CCTGGGCGGGCGCTAGGACCCGG 0: 1
1: 0
2: 2
3: 11
4: 148
Right 946702105 2:222424483-222424505 CCGCCCGCCCGGCCTCCGCCCGG 0: 1
1: 1
2: 9
3: 81
4: 541
946702086_946702094 -2 Left 946702086 2:222424430-222424452 CCTGGGCGGGCGCTAGGACCCGG 0: 1
1: 0
2: 2
3: 11
4: 148
Right 946702094 2:222424451-222424473 GGGCGGCGCACCTGTTGGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 65
946702086_946702093 -3 Left 946702086 2:222424430-222424452 CCTGGGCGGGCGCTAGGACCCGG 0: 1
1: 0
2: 2
3: 11
4: 148
Right 946702093 2:222424450-222424472 CGGGCGGCGCACCTGTTGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 199
946702086_946702095 3 Left 946702086 2:222424430-222424452 CCTGGGCGGGCGCTAGGACCCGG 0: 1
1: 0
2: 2
3: 11
4: 148
Right 946702095 2:222424456-222424478 GCGCACCTGTTGGCTGGGCCCGG 0: 1
1: 0
2: 1
3: 26
4: 215
946702086_946702096 4 Left 946702086 2:222424430-222424452 CCTGGGCGGGCGCTAGGACCCGG 0: 1
1: 0
2: 2
3: 11
4: 148
Right 946702096 2:222424457-222424479 CGCACCTGTTGGCTGGGCCCGGG 0: 1
1: 0
2: 2
3: 18
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946702086 Original CRISPR CCGGGTCCTAGCGCCCGCCC AGG (reversed) Intergenic