ID: 946702092

View in Genome Browser
Species Human (GRCh38)
Location 2:222424449-222424471
Sequence CAGCCAACAGGTGCGCCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946702092_946702109 18 Left 946702092 2:222424449-222424471 CCGGGCGGCGCACCTGTTGGCTG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 946702109 2:222424490-222424512 CCCGGCCTCCGCCCGGAGTGCGG 0: 1
1: 0
2: 2
3: 10
4: 171
946702092_946702118 29 Left 946702092 2:222424449-222424471 CCGGGCGGCGCACCTGTTGGCTG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 946702118 2:222424501-222424523 CCCGGAGTGCGGGATCGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 136
946702092_946702099 0 Left 946702092 2:222424449-222424471 CCGGGCGGCGCACCTGTTGGCTG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 946702099 2:222424472-222424494 GGCCCGGGGCCCCGCCCGCCCGG 0: 1
1: 0
2: 4
3: 90
4: 606
946702092_946702116 28 Left 946702092 2:222424449-222424471 CCGGGCGGCGCACCTGTTGGCTG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 114
946702092_946702111 19 Left 946702092 2:222424449-222424471 CCGGGCGGCGCACCTGTTGGCTG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 946702111 2:222424491-222424513 CCGGCCTCCGCCCGGAGTGCGGG 0: 1
1: 0
2: 0
3: 18
4: 187
946702092_946702113 24 Left 946702092 2:222424449-222424471 CCGGGCGGCGCACCTGTTGGCTG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 946702113 2:222424496-222424518 CTCCGCCCGGAGTGCGGGATCGG 0: 1
1: 0
2: 4
3: 1
4: 36
946702092_946702105 11 Left 946702092 2:222424449-222424471 CCGGGCGGCGCACCTGTTGGCTG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 946702105 2:222424483-222424505 CCGCCCGCCCGGCCTCCGCCCGG 0: 1
1: 1
2: 9
3: 81
4: 541
946702092_946702115 27 Left 946702092 2:222424449-222424471 CCGGGCGGCGCACCTGTTGGCTG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 946702115 2:222424499-222424521 CGCCCGGAGTGCGGGATCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 55
946702092_946702120 30 Left 946702092 2:222424449-222424471 CCGGGCGGCGCACCTGTTGGCTG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 946702120 2:222424502-222424524 CCGGAGTGCGGGATCGGCGGGGG 0: 1
1: 0
2: 3
3: 5
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946702092 Original CRISPR CAGCCAACAGGTGCGCCGCC CGG (reversed) Intergenic