ID: 946702098

View in Genome Browser
Species Human (GRCh38)
Location 2:222424461-222424483
Sequence GGGCCCCGGGCCCAGCCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 325}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946702098_946702122 26 Left 946702098 2:222424461-222424483 CCTGTTGGCTGGGCCCGGGGCCC 0: 1
1: 0
2: 6
3: 30
4: 325
Right 946702122 2:222424510-222424532 CGGGATCGGCGGGGGCGAGGCGG 0: 1
1: 0
2: 1
3: 31
4: 311
946702098_946702123 27 Left 946702098 2:222424461-222424483 CCTGTTGGCTGGGCCCGGGGCCC 0: 1
1: 0
2: 6
3: 30
4: 325
Right 946702123 2:222424511-222424533 GGGATCGGCGGGGGCGAGGCGGG 0: 1
1: 0
2: 1
3: 53
4: 556
946702098_946702121 23 Left 946702098 2:222424461-222424483 CCTGTTGGCTGGGCCCGGGGCCC 0: 1
1: 0
2: 6
3: 30
4: 325
Right 946702121 2:222424507-222424529 GTGCGGGATCGGCGGGGGCGAGG 0: 1
1: 0
2: 1
3: 34
4: 369
946702098_946702111 7 Left 946702098 2:222424461-222424483 CCTGTTGGCTGGGCCCGGGGCCC 0: 1
1: 0
2: 6
3: 30
4: 325
Right 946702111 2:222424491-222424513 CCGGCCTCCGCCCGGAGTGCGGG 0: 1
1: 0
2: 0
3: 18
4: 187
946702098_946702118 17 Left 946702098 2:222424461-222424483 CCTGTTGGCTGGGCCCGGGGCCC 0: 1
1: 0
2: 6
3: 30
4: 325
Right 946702118 2:222424501-222424523 CCCGGAGTGCGGGATCGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 136
946702098_946702113 12 Left 946702098 2:222424461-222424483 CCTGTTGGCTGGGCCCGGGGCCC 0: 1
1: 0
2: 6
3: 30
4: 325
Right 946702113 2:222424496-222424518 CTCCGCCCGGAGTGCGGGATCGG 0: 1
1: 0
2: 4
3: 1
4: 36
946702098_946702120 18 Left 946702098 2:222424461-222424483 CCTGTTGGCTGGGCCCGGGGCCC 0: 1
1: 0
2: 6
3: 30
4: 325
Right 946702120 2:222424502-222424524 CCGGAGTGCGGGATCGGCGGGGG 0: 1
1: 0
2: 3
3: 5
4: 160
946702098_946702105 -1 Left 946702098 2:222424461-222424483 CCTGTTGGCTGGGCCCGGGGCCC 0: 1
1: 0
2: 6
3: 30
4: 325
Right 946702105 2:222424483-222424505 CCGCCCGCCCGGCCTCCGCCCGG 0: 1
1: 1
2: 9
3: 81
4: 541
946702098_946702115 15 Left 946702098 2:222424461-222424483 CCTGTTGGCTGGGCCCGGGGCCC 0: 1
1: 0
2: 6
3: 30
4: 325
Right 946702115 2:222424499-222424521 CGCCCGGAGTGCGGGATCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 55
946702098_946702109 6 Left 946702098 2:222424461-222424483 CCTGTTGGCTGGGCCCGGGGCCC 0: 1
1: 0
2: 6
3: 30
4: 325
Right 946702109 2:222424490-222424512 CCCGGCCTCCGCCCGGAGTGCGG 0: 1
1: 0
2: 2
3: 10
4: 171
946702098_946702116 16 Left 946702098 2:222424461-222424483 CCTGTTGGCTGGGCCCGGGGCCC 0: 1
1: 0
2: 6
3: 30
4: 325
Right 946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946702098 Original CRISPR GGGCCCCGGGCCCAGCCAAC AGG (reversed) Intergenic