ID: 946702100

View in Genome Browser
Species Human (GRCh38)
Location 2:222424474-222424496
Sequence GGCCGGGCGGGCGGGGCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1265
Summary {0: 1, 1: 0, 2: 12, 3: 137, 4: 1115}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946702100_946702109 -7 Left 946702100 2:222424474-222424496 CCCGGGGCCCCGCCCGCCCGGCC 0: 1
1: 0
2: 12
3: 137
4: 1115
Right 946702109 2:222424490-222424512 CCCGGCCTCCGCCCGGAGTGCGG 0: 1
1: 0
2: 2
3: 10
4: 171
946702100_946702111 -6 Left 946702100 2:222424474-222424496 CCCGGGGCCCCGCCCGCCCGGCC 0: 1
1: 0
2: 12
3: 137
4: 1115
Right 946702111 2:222424491-222424513 CCGGCCTCCGCCCGGAGTGCGGG 0: 1
1: 0
2: 0
3: 18
4: 187
946702100_946702121 10 Left 946702100 2:222424474-222424496 CCCGGGGCCCCGCCCGCCCGGCC 0: 1
1: 0
2: 12
3: 137
4: 1115
Right 946702121 2:222424507-222424529 GTGCGGGATCGGCGGGGGCGAGG 0: 1
1: 0
2: 1
3: 34
4: 369
946702100_946702115 2 Left 946702100 2:222424474-222424496 CCCGGGGCCCCGCCCGCCCGGCC 0: 1
1: 0
2: 12
3: 137
4: 1115
Right 946702115 2:222424499-222424521 CGCCCGGAGTGCGGGATCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 55
946702100_946702120 5 Left 946702100 2:222424474-222424496 CCCGGGGCCCCGCCCGCCCGGCC 0: 1
1: 0
2: 12
3: 137
4: 1115
Right 946702120 2:222424502-222424524 CCGGAGTGCGGGATCGGCGGGGG 0: 1
1: 0
2: 3
3: 5
4: 160
946702100_946702124 19 Left 946702100 2:222424474-222424496 CCCGGGGCCCCGCCCGCCCGGCC 0: 1
1: 0
2: 12
3: 137
4: 1115
Right 946702124 2:222424516-222424538 CGGCGGGGGCGAGGCGGGAGTGG 0: 1
1: 0
2: 10
3: 162
4: 1188
946702100_946702113 -1 Left 946702100 2:222424474-222424496 CCCGGGGCCCCGCCCGCCCGGCC 0: 1
1: 0
2: 12
3: 137
4: 1115
Right 946702113 2:222424496-222424518 CTCCGCCCGGAGTGCGGGATCGG 0: 1
1: 0
2: 4
3: 1
4: 36
946702100_946702123 14 Left 946702100 2:222424474-222424496 CCCGGGGCCCCGCCCGCCCGGCC 0: 1
1: 0
2: 12
3: 137
4: 1115
Right 946702123 2:222424511-222424533 GGGATCGGCGGGGGCGAGGCGGG 0: 1
1: 0
2: 1
3: 53
4: 556
946702100_946702118 4 Left 946702100 2:222424474-222424496 CCCGGGGCCCCGCCCGCCCGGCC 0: 1
1: 0
2: 12
3: 137
4: 1115
Right 946702118 2:222424501-222424523 CCCGGAGTGCGGGATCGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 136
946702100_946702116 3 Left 946702100 2:222424474-222424496 CCCGGGGCCCCGCCCGCCCGGCC 0: 1
1: 0
2: 12
3: 137
4: 1115
Right 946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 114
946702100_946702125 22 Left 946702100 2:222424474-222424496 CCCGGGGCCCCGCCCGCCCGGCC 0: 1
1: 0
2: 12
3: 137
4: 1115
Right 946702125 2:222424519-222424541 CGGGGGCGAGGCGGGAGTGGCGG 0: 1
1: 0
2: 2
3: 136
4: 915
946702100_946702122 13 Left 946702100 2:222424474-222424496 CCCGGGGCCCCGCCCGCCCGGCC 0: 1
1: 0
2: 12
3: 137
4: 1115
Right 946702122 2:222424510-222424532 CGGGATCGGCGGGGGCGAGGCGG 0: 1
1: 0
2: 1
3: 31
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946702100 Original CRISPR GGCCGGGCGGGCGGGGCCCC GGG (reversed) Intergenic