ID: 946702101

View in Genome Browser
Species Human (GRCh38)
Location 2:222424475-222424497
Sequence AGGCCGGGCGGGCGGGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 991
Summary {0: 1, 1: 0, 2: 6, 3: 118, 4: 866}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946702101_946702109 -8 Left 946702101 2:222424475-222424497 CCGGGGCCCCGCCCGCCCGGCCT 0: 1
1: 0
2: 6
3: 118
4: 866
Right 946702109 2:222424490-222424512 CCCGGCCTCCGCCCGGAGTGCGG 0: 1
1: 0
2: 2
3: 10
4: 171
946702101_946702124 18 Left 946702101 2:222424475-222424497 CCGGGGCCCCGCCCGCCCGGCCT 0: 1
1: 0
2: 6
3: 118
4: 866
Right 946702124 2:222424516-222424538 CGGCGGGGGCGAGGCGGGAGTGG 0: 1
1: 0
2: 10
3: 162
4: 1188
946702101_946702126 30 Left 946702101 2:222424475-222424497 CCGGGGCCCCGCCCGCCCGGCCT 0: 1
1: 0
2: 6
3: 118
4: 866
Right 946702126 2:222424528-222424550 GGCGGGAGTGGCGGTGCCAGCGG 0: 1
1: 0
2: 4
3: 46
4: 524
946702101_946702113 -2 Left 946702101 2:222424475-222424497 CCGGGGCCCCGCCCGCCCGGCCT 0: 1
1: 0
2: 6
3: 118
4: 866
Right 946702113 2:222424496-222424518 CTCCGCCCGGAGTGCGGGATCGG 0: 1
1: 0
2: 4
3: 1
4: 36
946702101_946702121 9 Left 946702101 2:222424475-222424497 CCGGGGCCCCGCCCGCCCGGCCT 0: 1
1: 0
2: 6
3: 118
4: 866
Right 946702121 2:222424507-222424529 GTGCGGGATCGGCGGGGGCGAGG 0: 1
1: 0
2: 1
3: 34
4: 369
946702101_946702116 2 Left 946702101 2:222424475-222424497 CCGGGGCCCCGCCCGCCCGGCCT 0: 1
1: 0
2: 6
3: 118
4: 866
Right 946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 114
946702101_946702123 13 Left 946702101 2:222424475-222424497 CCGGGGCCCCGCCCGCCCGGCCT 0: 1
1: 0
2: 6
3: 118
4: 866
Right 946702123 2:222424511-222424533 GGGATCGGCGGGGGCGAGGCGGG 0: 1
1: 0
2: 1
3: 53
4: 556
946702101_946702111 -7 Left 946702101 2:222424475-222424497 CCGGGGCCCCGCCCGCCCGGCCT 0: 1
1: 0
2: 6
3: 118
4: 866
Right 946702111 2:222424491-222424513 CCGGCCTCCGCCCGGAGTGCGGG 0: 1
1: 0
2: 0
3: 18
4: 187
946702101_946702120 4 Left 946702101 2:222424475-222424497 CCGGGGCCCCGCCCGCCCGGCCT 0: 1
1: 0
2: 6
3: 118
4: 866
Right 946702120 2:222424502-222424524 CCGGAGTGCGGGATCGGCGGGGG 0: 1
1: 0
2: 3
3: 5
4: 160
946702101_946702115 1 Left 946702101 2:222424475-222424497 CCGGGGCCCCGCCCGCCCGGCCT 0: 1
1: 0
2: 6
3: 118
4: 866
Right 946702115 2:222424499-222424521 CGCCCGGAGTGCGGGATCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 55
946702101_946702125 21 Left 946702101 2:222424475-222424497 CCGGGGCCCCGCCCGCCCGGCCT 0: 1
1: 0
2: 6
3: 118
4: 866
Right 946702125 2:222424519-222424541 CGGGGGCGAGGCGGGAGTGGCGG 0: 1
1: 0
2: 2
3: 136
4: 915
946702101_946702122 12 Left 946702101 2:222424475-222424497 CCGGGGCCCCGCCCGCCCGGCCT 0: 1
1: 0
2: 6
3: 118
4: 866
Right 946702122 2:222424510-222424532 CGGGATCGGCGGGGGCGAGGCGG 0: 1
1: 0
2: 1
3: 31
4: 311
946702101_946702118 3 Left 946702101 2:222424475-222424497 CCGGGGCCCCGCCCGCCCGGCCT 0: 1
1: 0
2: 6
3: 118
4: 866
Right 946702118 2:222424501-222424523 CCCGGAGTGCGGGATCGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946702101 Original CRISPR AGGCCGGGCGGGCGGGGCCC CGG (reversed) Intergenic