ID: 946702103

View in Genome Browser
Species Human (GRCh38)
Location 2:222424482-222424504
Sequence CGGGCGGAGGCCGGGCGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1111
Summary {0: 1, 1: 3, 2: 12, 3: 123, 4: 972}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946702103_946702122 5 Left 946702103 2:222424482-222424504 CCCGCCCGCCCGGCCTCCGCCCG 0: 1
1: 3
2: 12
3: 123
4: 972
Right 946702122 2:222424510-222424532 CGGGATCGGCGGGGGCGAGGCGG 0: 1
1: 0
2: 1
3: 31
4: 311
946702103_946702127 26 Left 946702103 2:222424482-222424504 CCCGCCCGCCCGGCCTCCGCCCG 0: 1
1: 3
2: 12
3: 123
4: 972
Right 946702127 2:222424531-222424553 GGGAGTGGCGGTGCCAGCGGAGG 0: 1
1: 0
2: 2
3: 34
4: 540
946702103_946702113 -9 Left 946702103 2:222424482-222424504 CCCGCCCGCCCGGCCTCCGCCCG 0: 1
1: 3
2: 12
3: 123
4: 972
Right 946702113 2:222424496-222424518 CTCCGCCCGGAGTGCGGGATCGG 0: 1
1: 0
2: 4
3: 1
4: 36
946702103_946702120 -3 Left 946702103 2:222424482-222424504 CCCGCCCGCCCGGCCTCCGCCCG 0: 1
1: 3
2: 12
3: 123
4: 972
Right 946702120 2:222424502-222424524 CCGGAGTGCGGGATCGGCGGGGG 0: 1
1: 0
2: 3
3: 5
4: 160
946702103_946702125 14 Left 946702103 2:222424482-222424504 CCCGCCCGCCCGGCCTCCGCCCG 0: 1
1: 3
2: 12
3: 123
4: 972
Right 946702125 2:222424519-222424541 CGGGGGCGAGGCGGGAGTGGCGG 0: 1
1: 0
2: 2
3: 136
4: 915
946702103_946702126 23 Left 946702103 2:222424482-222424504 CCCGCCCGCCCGGCCTCCGCCCG 0: 1
1: 3
2: 12
3: 123
4: 972
Right 946702126 2:222424528-222424550 GGCGGGAGTGGCGGTGCCAGCGG 0: 1
1: 0
2: 4
3: 46
4: 524
946702103_946702128 27 Left 946702103 2:222424482-222424504 CCCGCCCGCCCGGCCTCCGCCCG 0: 1
1: 3
2: 12
3: 123
4: 972
Right 946702128 2:222424532-222424554 GGAGTGGCGGTGCCAGCGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 226
946702103_946702121 2 Left 946702103 2:222424482-222424504 CCCGCCCGCCCGGCCTCCGCCCG 0: 1
1: 3
2: 12
3: 123
4: 972
Right 946702121 2:222424507-222424529 GTGCGGGATCGGCGGGGGCGAGG 0: 1
1: 0
2: 1
3: 34
4: 369
946702103_946702118 -4 Left 946702103 2:222424482-222424504 CCCGCCCGCCCGGCCTCCGCCCG 0: 1
1: 3
2: 12
3: 123
4: 972
Right 946702118 2:222424501-222424523 CCCGGAGTGCGGGATCGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 136
946702103_946702124 11 Left 946702103 2:222424482-222424504 CCCGCCCGCCCGGCCTCCGCCCG 0: 1
1: 3
2: 12
3: 123
4: 972
Right 946702124 2:222424516-222424538 CGGCGGGGGCGAGGCGGGAGTGG 0: 1
1: 0
2: 10
3: 162
4: 1188
946702103_946702115 -6 Left 946702103 2:222424482-222424504 CCCGCCCGCCCGGCCTCCGCCCG 0: 1
1: 3
2: 12
3: 123
4: 972
Right 946702115 2:222424499-222424521 CGCCCGGAGTGCGGGATCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 55
946702103_946702116 -5 Left 946702103 2:222424482-222424504 CCCGCCCGCCCGGCCTCCGCCCG 0: 1
1: 3
2: 12
3: 123
4: 972
Right 946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 114
946702103_946702123 6 Left 946702103 2:222424482-222424504 CCCGCCCGCCCGGCCTCCGCCCG 0: 1
1: 3
2: 12
3: 123
4: 972
Right 946702123 2:222424511-222424533 GGGATCGGCGGGGGCGAGGCGGG 0: 1
1: 0
2: 1
3: 53
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946702103 Original CRISPR CGGGCGGAGGCCGGGCGGGC GGG (reversed) Intergenic