ID: 946702106

View in Genome Browser
Species Human (GRCh38)
Location 2:222424486-222424508
Sequence ACTCCGGGCGGAGGCCGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 244}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946702106_946702127 22 Left 946702106 2:222424486-222424508 CCCGCCCGGCCTCCGCCCGGAGT 0: 1
1: 0
2: 0
3: 17
4: 244
Right 946702127 2:222424531-222424553 GGGAGTGGCGGTGCCAGCGGAGG 0: 1
1: 0
2: 2
3: 34
4: 540
946702106_946702123 2 Left 946702106 2:222424486-222424508 CCCGCCCGGCCTCCGCCCGGAGT 0: 1
1: 0
2: 0
3: 17
4: 244
Right 946702123 2:222424511-222424533 GGGATCGGCGGGGGCGAGGCGGG 0: 1
1: 0
2: 1
3: 53
4: 556
946702106_946702124 7 Left 946702106 2:222424486-222424508 CCCGCCCGGCCTCCGCCCGGAGT 0: 1
1: 0
2: 0
3: 17
4: 244
Right 946702124 2:222424516-222424538 CGGCGGGGGCGAGGCGGGAGTGG 0: 1
1: 0
2: 10
3: 162
4: 1188
946702106_946702116 -9 Left 946702106 2:222424486-222424508 CCCGCCCGGCCTCCGCCCGGAGT 0: 1
1: 0
2: 0
3: 17
4: 244
Right 946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 114
946702106_946702120 -7 Left 946702106 2:222424486-222424508 CCCGCCCGGCCTCCGCCCGGAGT 0: 1
1: 0
2: 0
3: 17
4: 244
Right 946702120 2:222424502-222424524 CCGGAGTGCGGGATCGGCGGGGG 0: 1
1: 0
2: 3
3: 5
4: 160
946702106_946702125 10 Left 946702106 2:222424486-222424508 CCCGCCCGGCCTCCGCCCGGAGT 0: 1
1: 0
2: 0
3: 17
4: 244
Right 946702125 2:222424519-222424541 CGGGGGCGAGGCGGGAGTGGCGG 0: 1
1: 0
2: 2
3: 136
4: 915
946702106_946702115 -10 Left 946702106 2:222424486-222424508 CCCGCCCGGCCTCCGCCCGGAGT 0: 1
1: 0
2: 0
3: 17
4: 244
Right 946702115 2:222424499-222424521 CGCCCGGAGTGCGGGATCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 55
946702106_946702121 -2 Left 946702106 2:222424486-222424508 CCCGCCCGGCCTCCGCCCGGAGT 0: 1
1: 0
2: 0
3: 17
4: 244
Right 946702121 2:222424507-222424529 GTGCGGGATCGGCGGGGGCGAGG 0: 1
1: 0
2: 1
3: 34
4: 369
946702106_946702128 23 Left 946702106 2:222424486-222424508 CCCGCCCGGCCTCCGCCCGGAGT 0: 1
1: 0
2: 0
3: 17
4: 244
Right 946702128 2:222424532-222424554 GGAGTGGCGGTGCCAGCGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 226
946702106_946702126 19 Left 946702106 2:222424486-222424508 CCCGCCCGGCCTCCGCCCGGAGT 0: 1
1: 0
2: 0
3: 17
4: 244
Right 946702126 2:222424528-222424550 GGCGGGAGTGGCGGTGCCAGCGG 0: 1
1: 0
2: 4
3: 46
4: 524
946702106_946702118 -8 Left 946702106 2:222424486-222424508 CCCGCCCGGCCTCCGCCCGGAGT 0: 1
1: 0
2: 0
3: 17
4: 244
Right 946702118 2:222424501-222424523 CCCGGAGTGCGGGATCGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 136
946702106_946702122 1 Left 946702106 2:222424486-222424508 CCCGCCCGGCCTCCGCCCGGAGT 0: 1
1: 0
2: 0
3: 17
4: 244
Right 946702122 2:222424510-222424532 CGGGATCGGCGGGGGCGAGGCGG 0: 1
1: 0
2: 1
3: 31
4: 311
946702106_946702129 29 Left 946702106 2:222424486-222424508 CCCGCCCGGCCTCCGCCCGGAGT 0: 1
1: 0
2: 0
3: 17
4: 244
Right 946702129 2:222424538-222424560 GCGGTGCCAGCGGAGGGCACCGG 0: 1
1: 0
2: 0
3: 15
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946702106 Original CRISPR ACTCCGGGCGGAGGCCGGGC GGG (reversed) Intergenic