ID: 946702111

View in Genome Browser
Species Human (GRCh38)
Location 2:222424491-222424513
Sequence CCGGCCTCCGCCCGGAGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946702098_946702111 7 Left 946702098 2:222424461-222424483 CCTGTTGGCTGGGCCCGGGGCCC 0: 1
1: 0
2: 6
3: 30
4: 325
Right 946702111 2:222424491-222424513 CCGGCCTCCGCCCGGAGTGCGGG 0: 1
1: 0
2: 0
3: 18
4: 187
946702092_946702111 19 Left 946702092 2:222424449-222424471 CCGGGCGGCGCACCTGTTGGCTG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 946702111 2:222424491-222424513 CCGGCCTCCGCCCGGAGTGCGGG 0: 1
1: 0
2: 0
3: 18
4: 187
946702091_946702111 20 Left 946702091 2:222424448-222424470 CCCGGGCGGCGCACCTGTTGGCT 0: 1
1: 0
2: 0
3: 6
4: 63
Right 946702111 2:222424491-222424513 CCGGCCTCCGCCCGGAGTGCGGG 0: 1
1: 0
2: 0
3: 18
4: 187
946702100_946702111 -6 Left 946702100 2:222424474-222424496 CCCGGGGCCCCGCCCGCCCGGCC 0: 1
1: 0
2: 12
3: 137
4: 1115
Right 946702111 2:222424491-222424513 CCGGCCTCCGCCCGGAGTGCGGG 0: 1
1: 0
2: 0
3: 18
4: 187
946702101_946702111 -7 Left 946702101 2:222424475-222424497 CCGGGGCCCCGCCCGCCCGGCCT 0: 1
1: 0
2: 6
3: 118
4: 866
Right 946702111 2:222424491-222424513 CCGGCCTCCGCCCGGAGTGCGGG 0: 1
1: 0
2: 0
3: 18
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946702111 Original CRISPR CCGGCCTCCGCCCGGAGTGC GGG Intergenic