ID: 946702115

View in Genome Browser
Species Human (GRCh38)
Location 2:222424499-222424521
Sequence CGCCCGGAGTGCGGGATCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 55}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946702098_946702115 15 Left 946702098 2:222424461-222424483 CCTGTTGGCTGGGCCCGGGGCCC 0: 1
1: 0
2: 6
3: 30
4: 325
Right 946702115 2:222424499-222424521 CGCCCGGAGTGCGGGATCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 55
946702091_946702115 28 Left 946702091 2:222424448-222424470 CCCGGGCGGCGCACCTGTTGGCT 0: 1
1: 0
2: 0
3: 6
4: 63
Right 946702115 2:222424499-222424521 CGCCCGGAGTGCGGGATCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 55
946702100_946702115 2 Left 946702100 2:222424474-222424496 CCCGGGGCCCCGCCCGCCCGGCC 0: 1
1: 0
2: 12
3: 137
4: 1115
Right 946702115 2:222424499-222424521 CGCCCGGAGTGCGGGATCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 55
946702092_946702115 27 Left 946702092 2:222424449-222424471 CCGGGCGGCGCACCTGTTGGCTG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 946702115 2:222424499-222424521 CGCCCGGAGTGCGGGATCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 55
946702106_946702115 -10 Left 946702106 2:222424486-222424508 CCCGCCCGGCCTCCGCCCGGAGT 0: 1
1: 0
2: 0
3: 17
4: 244
Right 946702115 2:222424499-222424521 CGCCCGGAGTGCGGGATCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 55
946702101_946702115 1 Left 946702101 2:222424475-222424497 CCGGGGCCCCGCCCGCCCGGCCT 0: 1
1: 0
2: 6
3: 118
4: 866
Right 946702115 2:222424499-222424521 CGCCCGGAGTGCGGGATCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 55
946702103_946702115 -6 Left 946702103 2:222424482-222424504 CCCGCCCGCCCGGCCTCCGCCCG 0: 1
1: 3
2: 12
3: 123
4: 972
Right 946702115 2:222424499-222424521 CGCCCGGAGTGCGGGATCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 55
946702104_946702115 -7 Left 946702104 2:222424483-222424505 CCGCCCGCCCGGCCTCCGCCCGG 0: 1
1: 0
2: 12
3: 111
4: 1485
Right 946702115 2:222424499-222424521 CGCCCGGAGTGCGGGATCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 55
946702102_946702115 -5 Left 946702102 2:222424481-222424503 CCCCGCCCGCCCGGCCTCCGCCC 0: 1
1: 2
2: 17
3: 238
4: 1424
Right 946702115 2:222424499-222424521 CGCCCGGAGTGCGGGATCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946702115 Original CRISPR CGCCCGGAGTGCGGGATCGG CGG Exonic