ID: 946702116

View in Genome Browser
Species Human (GRCh38)
Location 2:222424500-222424522
Sequence GCCCGGAGTGCGGGATCGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 114}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946702106_946702116 -9 Left 946702106 2:222424486-222424508 CCCGCCCGGCCTCCGCCCGGAGT 0: 1
1: 0
2: 0
3: 17
4: 244
Right 946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 114
946702092_946702116 28 Left 946702092 2:222424449-222424471 CCGGGCGGCGCACCTGTTGGCTG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 114
946702098_946702116 16 Left 946702098 2:222424461-222424483 CCTGTTGGCTGGGCCCGGGGCCC 0: 1
1: 0
2: 6
3: 30
4: 325
Right 946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 114
946702104_946702116 -6 Left 946702104 2:222424483-222424505 CCGCCCGCCCGGCCTCCGCCCGG 0: 1
1: 0
2: 12
3: 111
4: 1485
Right 946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 114
946702107_946702116 -10 Left 946702107 2:222424487-222424509 CCGCCCGGCCTCCGCCCGGAGTG 0: 1
1: 0
2: 1
3: 14
4: 190
Right 946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 114
946702103_946702116 -5 Left 946702103 2:222424482-222424504 CCCGCCCGCCCGGCCTCCGCCCG 0: 1
1: 3
2: 12
3: 123
4: 972
Right 946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 114
946702101_946702116 2 Left 946702101 2:222424475-222424497 CCGGGGCCCCGCCCGCCCGGCCT 0: 1
1: 0
2: 6
3: 118
4: 866
Right 946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 114
946702102_946702116 -4 Left 946702102 2:222424481-222424503 CCCCGCCCGCCCGGCCTCCGCCC 0: 1
1: 2
2: 17
3: 238
4: 1424
Right 946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 114
946702091_946702116 29 Left 946702091 2:222424448-222424470 CCCGGGCGGCGCACCTGTTGGCT 0: 1
1: 0
2: 0
3: 6
4: 63
Right 946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 114
946702100_946702116 3 Left 946702100 2:222424474-222424496 CCCGGGGCCCCGCCCGCCCGGCC 0: 1
1: 0
2: 12
3: 137
4: 1115
Right 946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946702116 Original CRISPR GCCCGGAGTGCGGGATCGGC GGG Exonic
900337077 1:2169637-2169659 GCCCGGAGTTGGGGATGGGTGGG + Intronic
900416170 1:2535745-2535767 GCGCGGAGTGTGGGAACCGCCGG + Intergenic
905793457 1:40802447-40802469 GCCCCGAGAGCGGGAGGGGCCGG - Intronic
908703820 1:66930018-66930040 GCCTGGAGTGGCGGATCAGCTGG + Intronic
915686542 1:157639988-157640010 GCCAGGAGTGGGTGATTGGCAGG + Intergenic
917521194 1:175749654-175749676 GCCTGGGGTGGGGGATGGGCAGG - Intergenic
920367726 1:205456917-205456939 GCGCGGAGGGCGGGGTGGGCCGG - Intergenic
921903861 1:220475957-220475979 GCTCCGAGTGCGGGGCCGGCCGG + Intergenic
1063994988 10:11611214-11611236 GCCCGGAGCGTGGGGTCCGCGGG - Intronic
1071333288 10:84582355-84582377 GCACGGAGTGCGGGCTGGCCAGG + Intergenic
1076776908 10:132703008-132703030 CCCCGGTGTGTGGGCTCGGCAGG - Intronic
1076891077 10:133283712-133283734 GCAGGGAGTGCGGGAGAGGCAGG - Intronic
1078548111 11:12261023-12261045 GCCCGGGCTGGGGGATCCGCTGG - Intronic
1078821933 11:14891753-14891775 GCCCGGAGTGGGTCACCGGCAGG + Intronic
1088253373 11:107880740-107880762 GCCCGGAGTGCTGACTGGGCAGG - Intronic
1090293812 11:125569307-125569329 GCGCTGCGTGCGGGATCGTCCGG - Exonic
1091300247 11:134502974-134502996 GCCCGGGGTGATGGATCAGCAGG - Intergenic
1095465497 12:42484064-42484086 GATCGAAGGGCGGGATCGGCAGG - Intronic
1096191589 12:49623495-49623517 GCCGGGAGGGCGGGGCCGGCGGG - Exonic
1102487163 12:113266324-113266346 AGCCGGAGTGCGGGGACGGCGGG - Exonic
1104140486 12:125982891-125982913 GCCCTGAGTGCGGGGTCTCCAGG + Intergenic
1106790811 13:33153414-33153436 GCCAGGAGTGCAGGAACGGAGGG + Intronic
1113082344 13:106533279-106533301 TCCCGGAGTCCGGGAGAGGCGGG - Intronic
1118809093 14:69260716-69260738 GCCCGGCGTGCGCGCGCGGCTGG + Intronic
1122913149 14:104843573-104843595 GCCAGGAGGGAGGGAACGGCGGG - Intergenic
1123040288 14:105487586-105487608 GCCCTGAGTGGGGGACCCGCAGG + Intronic
1123055429 14:105567049-105567071 GCCCTGAGCGCGGGCTCTGCGGG + Intergenic
1123079881 14:105686893-105686915 GCCCTGAGTGCGGGCTCTGCGGG + Intergenic
1128454226 15:67823576-67823598 GGCGGGAGTCCGGGATCCGCCGG - Intronic
1132163619 15:99565289-99565311 GCCCGGAGTCCGGGGCCGGGCGG - Intergenic
1132544797 16:528104-528126 GCGGGGAGCGCGGGCTCGGCGGG + Intronic
1132583305 16:694953-694975 CCCGGGATTGGGGGATCGGCGGG - Intronic
1133026066 16:2989477-2989499 GCCCGGGGTGCTGGAGCAGCTGG - Intergenic
1136413156 16:30088821-30088843 GCATGGAGTGCAGGATCAGCTGG + Exonic
1136768430 16:32811388-32811410 GCTCTGAGGGCGGGAGCGGCAGG - Intergenic
1137785456 16:51134398-51134420 GCCCGGAGTGCGGGAGCCCCGGG + Intergenic
1138105870 16:54286929-54286951 GCCCCGCGCGCGGGATCCGCGGG - Intergenic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1141721753 16:85759825-85759847 GCCGGGAGGGCAGGATCAGCAGG + Intergenic
1142209871 16:88803925-88803947 GCGCGGAGTGCGGGCCTGGCGGG - Exonic
1203070822 16_KI270728v1_random:1073404-1073426 GCTCTGAGGGCGGGAGCGGCAGG - Intergenic
1143747274 17:9003595-9003617 GCCCGGGGCGCGGGCGCGGCAGG - Intergenic
1146716293 17:35089319-35089341 GCGCGGAGGGCGGGAGCGGCCGG - Exonic
1146912518 17:36657871-36657893 GCTCGGGGTGGGGGCTCGGCCGG + Intergenic
1148437506 17:47694988-47695010 CCCCGGAGAGGGGGCTCGGCAGG - Intronic
1149626336 17:58083303-58083325 GCCCGCAGTGCGGGGCCGGGCGG + Intergenic
1152821586 17:82440282-82440304 GCGCGGAGAGCGGGACCCGCAGG + Intronic
1159289304 18:66395895-66395917 GCTCTGAGTGCGGGACCCGCCGG - Intergenic
1160204772 18:76823084-76823106 GCCCGGGGCGCGGTATCCGCAGG - Intronic
1161006909 19:1941534-1941556 GTCCGGAGCACGGGGTCGGCAGG - Intronic
1161256877 19:3314696-3314718 GACCGGAGTGCGGGCTGGGCCGG - Intergenic
1162481391 19:10928894-10928916 GCCGGGAGTGTGGGCGCGGCTGG + Exonic
1164644009 19:29844932-29844954 GCCCGCACTGCGGGAGGGGCAGG + Intergenic
1165089303 19:33374186-33374208 GCCGGGAGCGCGCGAACGGCCGG + Intronic
1166060003 19:40320302-40320324 CCCGGGAGTGCTGGATCGGGAGG - Exonic
1166385026 19:42376004-42376026 CCGCGGCGTGCGGGACCGGCTGG + Exonic
1168323617 19:55525730-55525752 GCCCGGTGTGTGGGCACGGCGGG + Intergenic
927896394 2:26785480-26785502 GCGGGGACGGCGGGATCGGCGGG - Intronic
937854155 2:126660594-126660616 GCCCTGAGTGGGGGACAGGCGGG - Intronic
946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG + Exonic
947118961 2:226797818-226797840 GCTCTCAGTGCGTGATCGGCGGG + Exonic
948231375 2:236351752-236351774 GCCCGCAGCGGGGGATAGGCAGG + Intronic
948845063 2:240679181-240679203 ACCCGGAGTGAAGGATCCGCAGG + Intronic
948848797 2:240695698-240695720 ACCCGGAGTGAAGGATCCGCAGG - Intronic
1171123420 20:22583684-22583706 GTGCGGAGTGCGGGGGCGGCTGG + Intronic
1173495408 20:43514460-43514482 GCCTGGAGTGAGGGTTTGGCTGG + Intronic
1175443791 20:59007236-59007258 GCCCAAAGTGCGGGGTCGGCCGG - Exonic
1175731183 20:61354824-61354846 GCCAGGGGTGCAGGAGCGGCTGG + Intronic
1176029829 20:63006595-63006617 GCCCGGAGTGCCGTAGCCGCGGG + Exonic
1176546970 21:8206340-8206362 CCCCGGAGTGGGGGGTTGGCCGG + Intergenic
1176554875 21:8250549-8250571 CCCCGGAGTGGGGGGTTGGCCGG + Intergenic
1176565921 21:8389387-8389409 CCCCGGAGTGGGGGGTTGGCCGG + Intergenic
1176573796 21:8433574-8433596 CCCCGGAGTGGGGGGTTGGCCGG + Intergenic
1179561550 21:42219073-42219095 GCCCCGAGCGCGCGATTGGCCGG - Intronic
1179951069 21:44709073-44709095 GCTGGGAGTGCGGGAGCTGCAGG - Intronic
1182236972 22:28883727-28883749 GCGCGGAGGGCGGGCGCGGCCGG - Exonic
1184247890 22:43244893-43244915 GCCCTGATTGAGGGATCAGCAGG - Intronic
1203251845 22_KI270733v1_random:122625-122647 CCCCGGAGTGGGGGGTTGGCCGG + Intergenic
1203259896 22_KI270733v1_random:167708-167730 CCCCGGAGTGGGGGGTTGGCCGG + Intergenic
949105742 3:197977-197999 GCCCGGAGAGTGGGAACGGAGGG - Intronic
951905578 3:27703538-27703560 GCCAGGAATGCTGGCTCGGCTGG + Intergenic
953026482 3:39148160-39148182 GCCCAGGGTGGGGGATTGGCTGG - Intronic
962071212 3:132035163-132035185 GCCCAGACTGCGGGCGCGGCAGG - Exonic
966874660 3:184315135-184315157 GCCCGGAGGGCGGGCGGGGCCGG - Intronic
968534415 4:1113985-1114007 GCCCGGGGAGCGGGATAGGAGGG + Intergenic
968653496 4:1769094-1769116 CCCCGGAGGGCTGTATCGGCGGG + Intergenic
983369704 4:166842813-166842835 GCCGGCAGTGCGGGACTGGCAGG - Intronic
984915398 4:184718749-184718771 GCCCAGATTGCTGGATCGGAGGG + Intronic
985542601 5:493815-493837 GCCCGGAGTGGGGGAGCCGTCGG - Intronic
990308605 5:54517797-54517819 GCGCGGAGGGCGCGACCGGCTGG + Exonic
996379022 5:122845461-122845483 GCCCAGGGCGCGGGAGCGGCCGG + Exonic
1001071300 5:168587498-168587520 GCCAGGAGGCAGGGATCGGCAGG - Intergenic
1001775486 5:174326323-174326345 GACCGGAGTGGGGGATCCGCTGG + Intergenic
1002132911 5:177092334-177092356 GCCCGGCCTGCAGGATGGGCCGG - Exonic
1002419316 5:179137503-179137525 GGCCGGGCTGCGGGCTCGGCAGG - Intronic
1009402620 6:63274920-63274942 GCCCCTGGTGCGGGATCCGCTGG - Intergenic
1013050237 6:106526729-106526751 GCCAGGAGTTCGAGATCAGCAGG + Intronic
1017118991 6:151006189-151006211 GCCGGGAGGGTGGGATGGGCGGG + Intronic
1018395240 6:163373409-163373431 GCCAGGCGTGCAGGAGCGGCAGG + Intergenic
1019444609 7:1064840-1064862 GCCCTGAGTGTGGGGTGGGCTGG - Intronic
1019531302 7:1504699-1504721 TCCCGGAGAGCGGGGGCGGCCGG + Intergenic
1020669220 7:11085688-11085710 GGCTGGAGTGCGGGAACTGCAGG + Intronic
1021731207 7:23597355-23597377 CCCCCGAGTGCGGGAAGGGCCGG + Intergenic
1023000314 7:35801414-35801436 GCCCGGGGCGCGGCAGCGGCGGG + Intronic
1023779422 7:43642237-43642259 GCCAGGAGTTCGAGATCAGCTGG + Intronic
1023972287 7:45000230-45000252 GCCGGGAGCGCGGGGGCGGCGGG + Intronic
1029746316 7:102517509-102517531 GGCCGTGGTGGGGGATCGGCGGG - Intronic
1029764254 7:102616488-102616510 GGCCGTGGTGGGGGATCGGCGGG - Intronic
1035020297 7:155796877-155796899 GCCCTGAGTCCGGGACCCGCAGG - Intergenic
1044734792 8:95268732-95268754 GCGCGGACTGCGGGCTCTGCGGG + Intronic
1047734700 8:127754977-127754999 GCCAGGAGTTCGAGATCAGCCGG + Intergenic
1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG + Exonic
1049262312 8:141646333-141646355 GCCTGGAGTGAGGGATCAGACGG - Intergenic
1049762447 8:144337382-144337404 GCCTGGGGCGCGGGATCTGCGGG + Intergenic
1053118374 9:35525587-35525609 GCCAGGAGTTCGAGATCAGCTGG + Intronic
1057605703 9:96496636-96496658 GCCTGGATTGCGGGGTCAGCCGG - Intronic
1060979945 9:127786065-127786087 GCCTGGAGTGCGGCGGCGGCGGG + Exonic
1203769002 EBV:39875-39897 GCCCTGGGGGAGGGATCGGCGGG - Intergenic
1203468247 Un_GL000220v1:105776-105798 CCCCGGAGTGGGGGGTTGGCCGG + Intergenic
1203476068 Un_GL000220v1:149748-149770 CCCCGGAGTGGGGGGTTGGCCGG + Intergenic
1187281437 X:17860926-17860948 GCCCGGAGGCCGGGGCCGGCTGG - Intronic
1190244514 X:48682393-48682415 GCCCGGAGTGCGAGCCAGGCAGG - Intronic