ID: 946702128

View in Genome Browser
Species Human (GRCh38)
Location 2:222424532-222424554
Sequence GGAGTGGCGGTGCCAGCGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 226}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946702108_946702128 19 Left 946702108 2:222424490-222424512 CCCGGCCTCCGCCCGGAGTGCGG 0: 1
1: 0
2: 1
3: 19
4: 147
Right 946702128 2:222424532-222424554 GGAGTGGCGGTGCCAGCGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 226
946702106_946702128 23 Left 946702106 2:222424486-222424508 CCCGCCCGGCCTCCGCCCGGAGT 0: 1
1: 0
2: 0
3: 17
4: 244
Right 946702128 2:222424532-222424554 GGAGTGGCGGTGCCAGCGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 226
946702117_946702128 8 Left 946702117 2:222424501-222424523 CCCGGAGTGCGGGATCGGCGGGG 0: 1
1: 0
2: 1
3: 10
4: 168
Right 946702128 2:222424532-222424554 GGAGTGGCGGTGCCAGCGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 226
946702110_946702128 18 Left 946702110 2:222424491-222424513 CCGGCCTCCGCCCGGAGTGCGGG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 946702128 2:222424532-222424554 GGAGTGGCGGTGCCAGCGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 226
946702114_946702128 11 Left 946702114 2:222424498-222424520 CCGCCCGGAGTGCGGGATCGGCG 0: 1
1: 0
2: 0
3: 5
4: 52
Right 946702128 2:222424532-222424554 GGAGTGGCGGTGCCAGCGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 226
946702107_946702128 22 Left 946702107 2:222424487-222424509 CCGCCCGGCCTCCGCCCGGAGTG 0: 1
1: 0
2: 1
3: 14
4: 190
Right 946702128 2:222424532-222424554 GGAGTGGCGGTGCCAGCGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 226
946702112_946702128 14 Left 946702112 2:222424495-222424517 CCTCCGCCCGGAGTGCGGGATCG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 946702128 2:222424532-222424554 GGAGTGGCGGTGCCAGCGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 226
946702104_946702128 26 Left 946702104 2:222424483-222424505 CCGCCCGCCCGGCCTCCGCCCGG 0: 1
1: 0
2: 12
3: 111
4: 1485
Right 946702128 2:222424532-222424554 GGAGTGGCGGTGCCAGCGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 226
946702102_946702128 28 Left 946702102 2:222424481-222424503 CCCCGCCCGCCCGGCCTCCGCCC 0: 1
1: 2
2: 17
3: 238
4: 1424
Right 946702128 2:222424532-222424554 GGAGTGGCGGTGCCAGCGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 226
946702103_946702128 27 Left 946702103 2:222424482-222424504 CCCGCCCGCCCGGCCTCCGCCCG 0: 1
1: 3
2: 12
3: 123
4: 972
Right 946702128 2:222424532-222424554 GGAGTGGCGGTGCCAGCGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 226
946702119_946702128 7 Left 946702119 2:222424502-222424524 CCGGAGTGCGGGATCGGCGGGGG 0: 1
1: 0
2: 3
3: 5
4: 81
Right 946702128 2:222424532-222424554 GGAGTGGCGGTGCCAGCGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946702128 Original CRISPR GGAGTGGCGGTGCCAGCGGA GGG Exonic