ID: 946708723

View in Genome Browser
Species Human (GRCh38)
Location 2:222485360-222485382
Sequence TGTCAAATGCGGGGGTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946708723_946708732 15 Left 946708723 2:222485360-222485382 CCTTCCCACCCCCGCATTTGACA 0: 1
1: 0
2: 1
3: 14
4: 206
Right 946708732 2:222485398-222485420 ATTTTTCACACGAACTCGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 74
946708723_946708733 30 Left 946708723 2:222485360-222485382 CCTTCCCACCCCCGCATTTGACA 0: 1
1: 0
2: 1
3: 14
4: 206
Right 946708733 2:222485413-222485435 TCGAAAGGCCAGAGCATCACAGG 0: 1
1: 0
2: 1
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946708723 Original CRISPR TGTCAAATGCGGGGGTGGGA AGG (reversed) Intronic
900756060 1:4435685-4435707 TGGCAAATGCAGGGGGAGGAGGG - Intergenic
901061495 1:6473973-6473995 TGTCAGGGGAGGGGGTGGGAAGG - Intronic
901629544 1:10641468-10641490 TATCAGATATGGGGGTGGGATGG + Intronic
903290050 1:22305223-22305245 TACCAAAGGCTGGGGTGGGAGGG + Intergenic
903570939 1:24304511-24304533 TCTGAAATGAGGTGGTGGGAAGG - Intergenic
903772358 1:25771926-25771948 TGTAAAATGCCTGGCTGGGAGGG - Intronic
903813104 1:26045782-26045804 TGGCAAATGCGGAGGTGCGTCGG + Intronic
904523270 1:31112551-31112573 TAGAAAATGGGGGGGTGGGAAGG + Intergenic
905092183 1:35438481-35438503 TGACAGATGCAGGGGTTGGAGGG - Intronic
905804157 1:40863811-40863833 TGTCAAATGCGTGGAGGGTAAGG - Intergenic
907334484 1:53691348-53691370 TGTCTCATGTGGTGGTGGGAGGG - Intronic
910169782 1:84365932-84365954 TGACAAATGACAGGGTGGGAGGG - Intronic
911344918 1:96684748-96684770 AGTCTAATCTGGGGGTGGGAGGG + Intergenic
913343434 1:117783158-117783180 TGTCATTTGCAGGAGTGGGAAGG + Intergenic
918305629 1:183243463-183243485 TGTCATGTGAGTGGGTGGGATGG + Exonic
920535866 1:206736155-206736177 TGCTAAATGCCTGGGTGGGATGG + Intergenic
921678610 1:218005786-218005808 TGTCAAATGTTGCGGAGGGATGG - Intergenic
1063498080 10:6528383-6528405 TGTCATAGGCTGGGGTGGGGTGG + Intronic
1064744321 10:18463888-18463910 TGTCAAAGGCCTGGCTGGGAAGG - Intronic
1066014567 10:31227831-31227853 TGTAACATGCAGGGGTGGAATGG + Intergenic
1069720959 10:70549073-70549095 TGTTAAATGTGGGGAGGGGAAGG + Intronic
1069797990 10:71065401-71065423 TGGCAAGTGTTGGGGTGGGATGG - Intergenic
1070210111 10:74308879-74308901 TTTCAAACTCAGGGGTGGGAGGG - Intronic
1070331062 10:75417636-75417658 TTTGAAATGCAGGGGTGGGTTGG + Intergenic
1070984224 10:80674207-80674229 TGTGAAATGTGGAGGTGGGAGGG - Intergenic
1071177599 10:82944512-82944534 TTGCAAATGTGGGGGTGGAAAGG + Intronic
1072290880 10:93963339-93963361 TGTCCAGGGCTGGGGTGGGAAGG + Intergenic
1073044380 10:100628164-100628186 TGTCAGAGGCGGGGGTCGGGAGG - Intergenic
1075036843 10:119076563-119076585 TGTCAGGGGTGGGGGTGGGAGGG + Intronic
1075746177 10:124729311-124729333 TGTCAAAGGTGGCAGTGGGATGG + Intronic
1076671726 10:132124511-132124533 TGTGATGTGCCGGGGTGGGATGG - Intronic
1076882838 10:133247978-133248000 TGGCAGGTGCGGGGGTGCGACGG - Intergenic
1078706477 11:13748590-13748612 TGTAAAATGCAGGGCAGGGAAGG - Intergenic
1081572115 11:44298277-44298299 TTGCATATGCCGGGGTGGGACGG + Intronic
1081855825 11:46303096-46303118 TGGCAAATGTGGTGGTGGCAAGG - Intronic
1082205085 11:49423608-49423630 TGTAAAATGAGGGGTTTGGAAGG - Intergenic
1082665960 11:55976585-55976607 TGCCAAATGCTGGGATGGGATGG - Intergenic
1085150972 11:74252684-74252706 TGTCAAAACCGTGTGTGGGAGGG - Intronic
1086270845 11:85064912-85064934 TGTCAAACGTGGGGTGGGGAAGG - Intronic
1086641563 11:89164137-89164159 TGTCTAATTTGGGGGTGGGGAGG + Intergenic
1086650010 11:89276937-89276959 TGTAAAATGAGGGGTTTGGAAGG + Intronic
1087676620 11:101169837-101169859 TGTTGGATGCTGGGGTGGGATGG + Intergenic
1088629966 11:111765776-111765798 GGTAGAAAGCGGGGGTGGGATGG - Intronic
1089015565 11:115162427-115162449 TGTAAAATGAAGGGGTTGGACGG + Intergenic
1089439448 11:118502998-118503020 TCTCAAATGGAGGTGTGGGAAGG - Exonic
1089513853 11:119018991-119019013 TGGCGGGTGCGGGGGTGGGAGGG + Intronic
1089991951 11:122869827-122869849 TGTGAAAACTGGGGGTGGGAGGG + Intronic
1090249709 11:125242643-125242665 TGTGCAATGCGGGGCAGGGATGG + Intronic
1090549792 11:127807232-127807254 TGATAAATGCTGGGCTGGGAGGG + Intergenic
1091098107 11:132842806-132842828 TGTCAAATGAGAGGGTGGCGGGG - Intronic
1091781222 12:3215703-3215725 TGGGAAGTGTGGGGGTGGGAGGG + Intronic
1092954329 12:13535542-13535564 TGTAAAATGAGGAGTTGGGAGGG + Intergenic
1099180372 12:79468685-79468707 TGTAATATCCGGGGGTGGGGGGG + Intergenic
1100120743 12:91366755-91366777 TGTAGAAGGCTGGGGTGGGATGG - Intergenic
1100574339 12:95875689-95875711 TGTGAAATGTGGGGTGGGGAAGG - Intronic
1100789984 12:98119817-98119839 TCTAAAATGCAGGGGTGGCAGGG - Intergenic
1101549574 12:105749445-105749467 TCTCAAATTCAGAGGTGGGAAGG + Intergenic
1102158147 12:110746825-110746847 TGTCAGAAGTGGGGGTTGGAAGG + Intergenic
1102247832 12:111366450-111366472 GATCAGATGCGGGGGTGAGAGGG - Intronic
1102647480 12:114413287-114413309 TGCAAAATGCTGGGGAGGGAAGG - Intergenic
1103248105 12:119475563-119475585 CATCAAATGCGCGGGTGGGAGGG + Intronic
1106414686 13:29536943-29536965 TGTCCCATGTGAGGGTGGGATGG - Intronic
1112820953 13:103334487-103334509 TGTCAAATGTGAGCGTCGGAGGG + Intergenic
1113642381 13:111967103-111967125 TGACAAGTGTGGGGGTGGCAGGG + Intergenic
1117106800 14:52405621-52405643 GGTCACATGCAGGGTTGGGAGGG - Intergenic
1117440035 14:55750968-55750990 TGCCAGAGGCTGGGGTGGGAGGG - Intergenic
1118400033 14:65371090-65371112 AGTCAAATGGGAGTGTGGGAGGG + Intergenic
1118480183 14:66156827-66156849 ACTCAAGTGGGGGGGTGGGAGGG - Intergenic
1118482108 14:66177535-66177557 AGTCAAATGCAGTGGTGAGAAGG + Intergenic
1121307912 14:92918357-92918379 TGTAAAATACCAGGGTGGGAGGG - Intergenic
1124097906 15:26666608-26666630 TGTCAAATGCAGGGCAGGGCAGG + Intronic
1126148086 15:45496312-45496334 TCTTAAATGGGGGAGTGGGAGGG - Intronic
1128260240 15:66228082-66228104 TGCCAAATGAGGGGGTGGAAAGG + Intronic
1128997310 15:72306516-72306538 GATCAAATTTGGGGGTGGGAGGG + Intronic
1129535446 15:76310848-76310870 TGTCAAGGGCGGGGGTGGGGTGG - Intronic
1129817360 15:78566270-78566292 TTTCAAATGCTGCGGTGGGTAGG - Intronic
1129823571 15:78620297-78620319 CGTCAAATGAGGAGGTGGGCGGG + Intronic
1132167539 15:99610424-99610446 TGTCAATTTCGGGGGGGGGTGGG - Intronic
1134662366 16:15993742-15993764 GCTCACATGCGGGGGTGGGTGGG + Intronic
1134688094 16:16172439-16172461 GGATAAATGAGGGGGTGGGATGG + Intronic
1136003246 16:27312074-27312096 TGTCACTTCCGGGGGTGGGTTGG + Intergenic
1136383083 16:29905975-29905997 TCTCTACTGCGGGGGTGGGCGGG + Exonic
1137860535 16:51842026-51842048 AGACAAATGCCTGGGTGGGAGGG - Intergenic
1140344531 16:74200066-74200088 TGCCAAATGCTGGGGTAGGGGGG + Intergenic
1140877868 16:79169702-79169724 TGCCAAATGGGTGGGTGGGCAGG + Intronic
1142954814 17:3514477-3514499 TGTCAAATGGGAGGGTTGAATGG - Intronic
1145257118 17:21331816-21331838 TGTTTAGTGAGGGGGTGGGAGGG - Intergenic
1145319519 17:21756222-21756244 TGTTTAGTGAGGGGGTGGGAGGG + Intergenic
1146446820 17:32938800-32938822 TCTGAAATGTGGGGTTGGGAAGG - Intronic
1148326449 17:46786062-46786084 TGTGAAATGAAGGGGTGGGGGGG - Intronic
1148871577 17:50661578-50661600 TCTCAAATGAGAGGGTGGGAAGG + Intronic
1150629026 17:66864254-66864276 TTTCAAATGGGGGTCTGGGAAGG - Intronic
1150926463 17:69537507-69537529 TGTCAAATGCTGTGGTGAGGTGG + Intronic
1151702422 17:75750485-75750507 TCTCCCATGCGGGGGTGGGAGGG - Intronic
1152323549 17:79622709-79622731 GGTGAAATGAGGTGGTGGGATGG - Intergenic
1152431934 17:80253081-80253103 TGCCACCTGCGGGGGAGGGACGG + Exonic
1153300237 18:3585891-3585913 TGTGATAAGTGGGGGTGGGAGGG + Intronic
1153530390 18:6040326-6040348 TGTCACATCTTGGGGTGGGAGGG + Intronic
1153541681 18:6162738-6162760 TGTCAAATGCCTGTGTGGCATGG - Intronic
1154344260 18:13529178-13529200 TGCCAAATGAGGGGGTGGCTGGG - Intronic
1154385927 18:13891805-13891827 TGTCAAATGTTGAGGTGGGATGG - Intronic
1155726271 18:29088076-29088098 TGTCAAATGTGGTGGTGGCAGGG + Intergenic
1156510755 18:37634717-37634739 TGTCAAATTCGGTTGGGGGACGG - Intergenic
1157969363 18:52248529-52248551 TCTCAAACTCGGGGGTTGGAGGG + Intergenic
1158770672 18:60513402-60513424 TGTGGAATGCGTGGGTGTGAGGG - Intergenic
1160969857 19:1762733-1762755 GGTGGGATGCGGGGGTGGGATGG - Intronic
1162393617 19:10404014-10404036 TGTCTAAATCGGGGGTGGTATGG + Intronic
1162812251 19:13171330-13171352 TGCCAAATGTTGGGGTGGGGTGG + Intergenic
1163272365 19:16261970-16261992 TGTCAAACGGGGGCCTGGGAGGG + Intergenic
1163281810 19:16323114-16323136 TGTGAGATGAGGGAGTGGGAAGG - Intergenic
1163315771 19:16539553-16539575 TTTGAGATGCGGGGGTGGGGTGG - Intronic
1163454125 19:17396025-17396047 TGGGAAAGGCGGGGGTGGGGGGG - Intergenic
1163980882 19:20898932-20898954 TGGCAAATGAGTGGGTGAGAGGG - Intergenic
1166326576 19:42054481-42054503 GGACAGAGGCGGGGGTGGGATGG + Intronic
1167163508 19:47782436-47782458 TTTCAATTGCTGGGTTGGGAAGG - Intronic
1167452210 19:49577929-49577951 TGCCAAAGACTGGGGTGGGAAGG + Intronic
1168287317 19:55341204-55341226 GGACAAAAGCGGGGGTGGGGAGG - Intronic
925258066 2:2506859-2506881 TTTAAAAGGCGTGGGTGGGAAGG - Intergenic
925278525 2:2667323-2667345 TGTCAAATGCAAGGGAGGGTCGG + Intergenic
926936328 2:18089325-18089347 GGGCAACTACGGGGGTGGGAGGG + Intronic
927028859 2:19099791-19099813 TGTGAATTGGGGGTGTGGGAGGG - Intergenic
930168691 2:48229581-48229603 TGTCTTATGCGGCGGTGGGGAGG - Intergenic
932757761 2:74420674-74420696 TGTCAGATGCGAGGCTGGGAGGG - Intronic
938407575 2:131040939-131040961 TGCCAAAAGCGGCGGTGGTAGGG - Intronic
938569227 2:132546883-132546905 TATCAAATGAAGGGGAGGGAAGG + Intronic
939596882 2:144136320-144136342 TGTCAAAAGAGGGGAGGGGAGGG + Intronic
941497016 2:166218253-166218275 TGTAAAATGGGGTGGGGGGAGGG + Intronic
942461860 2:176174099-176174121 TGTTAGATTTGGGGGTGGGAGGG + Intergenic
942529029 2:176888357-176888379 TACCAAAGGCTGGGGTGGGATGG - Intergenic
944690597 2:202155362-202155384 TGTTCGATGCTGGGGTGGGAGGG - Intronic
946708723 2:222485360-222485382 TGTCAAATGCGGGGGTGGGAAGG - Intronic
948641619 2:239379011-239379033 TGTCAGCCGCAGGGGTGGGACGG + Intronic
1170497302 20:16938612-16938634 CGTCTAATTCTGGGGTGGGAAGG - Intergenic
1170749870 20:19136120-19136142 TGAAAAATGTGGGGATGGGAAGG - Intergenic
1173000664 20:39102953-39102975 TCTGAAATGGCGGGGTGGGATGG + Intergenic
1173310578 20:41892975-41892997 TTTCAATTGCTGGGGTGAGAAGG + Intergenic
1176949122 21:15023046-15023068 TGTCTAGGGCTGGGGTGGGAAGG + Intronic
1177564645 21:22804133-22804155 TATCAGGTGTGGGGGTGGGACGG + Intergenic
1180147577 21:45929903-45929925 GGTCAACTGCTGGGGTAGGAGGG - Exonic
1181766005 22:25092616-25092638 GGTCCAGTGCTGGGGTGGGATGG + Intronic
1182963844 22:34503251-34503273 TGACAAATGAGAGGGTGAGAAGG + Intergenic
1183330254 22:37216189-37216211 TGTGGGATGGGGGGGTGGGAGGG - Intergenic
1184347612 22:43923431-43923453 TGTTAAGTCGGGGGGTGGGAGGG - Intergenic
950219331 3:11182647-11182669 TGTGAAATGGAGGGGAGGGAGGG + Intronic
954645899 3:52131357-52131379 TATAAAATGAGGGGGTGAGATGG + Intronic
955663479 3:61326115-61326137 GGTAAAATGCTGGGGAGGGAAGG - Intergenic
956743190 3:72290936-72290958 TGTCAAATGCGTGGTGGAGAGGG + Intergenic
959110054 3:102112046-102112068 TTTCAACTGTGGGGGTGGGGTGG + Intronic
963764070 3:149315687-149315709 CTTAAAATGGGGGGGTGGGAGGG - Intergenic
967877446 3:194276860-194276882 TGTAAAATAAGGGGGTTGGAAGG + Intergenic
968734125 4:2286342-2286364 TGCCCTTTGCGGGGGTGGGAGGG + Intronic
969658318 4:8510582-8510604 TGGCAACTGCAGTGGTGGGAGGG + Intergenic
969872679 4:10114815-10114837 CCTCAAATGAGGGGGTGGGCGGG - Intronic
970411046 4:15808228-15808250 TGTGAAATGTGGGGTGGGGAGGG - Intronic
973618877 4:52707846-52707868 TGTCTGCTGTGGGGGTGGGAGGG + Intergenic
979429108 4:120605427-120605449 TGTCAAAGGCTGGGAAGGGAAGG + Intergenic
980130227 4:128811129-128811151 TTGCAAATGCGGGAGAGGGATGG + Intronic
980166949 4:129240760-129240782 TGTATGAGGCGGGGGTGGGAGGG - Intergenic
982276313 4:153640023-153640045 TGTCTAAAGCGAGGGTGGGAGGG + Intergenic
983673170 4:170261667-170261689 TGTCCTATGCAGGGATGGGATGG + Intergenic
985131362 4:186741543-186741565 TGTCAAATGTGGGGAGGGTATGG - Intergenic
986007336 5:3678820-3678842 TACACAATGCGGGGGTGGGAAGG - Intergenic
989201872 5:38772188-38772210 TGGCAAATGCGGATGTGTGAAGG + Intergenic
991595347 5:68298893-68298915 TATCAAGTGGGGTGGTGGGAGGG + Exonic
992859374 5:80895640-80895662 TGTCAAATGCAGGGTGGGGTGGG - Intergenic
992911047 5:81396458-81396480 TTTAAAATGCTGGAGTGGGAAGG + Intergenic
993064779 5:83083959-83083981 TGTAAAATGCAGAGGTAGGAAGG - Intronic
998378180 5:141705190-141705212 TGTAAAATCCTGAGGTGGGATGG - Intergenic
998381597 5:141729837-141729859 TGGGATATGCGGGGGTGGGGTGG - Intergenic
998859210 5:146426400-146426422 TGCCAAAAGTGGGGGTGGGGAGG - Intergenic
999325776 5:150642512-150642534 TGTCAAAGGTGGGGGTGGGGAGG - Intronic
1001531831 5:172468457-172468479 TGCCAGTTGGGGGGGTGGGAGGG - Intergenic
1002074656 5:176701027-176701049 TGTCAGAAGTGGGGCTGGGATGG - Intergenic
1003426116 6:5999405-5999427 TGTCTAAAGCGGGGGTGGGGGGG + Intronic
1003619004 6:7680922-7680944 TGACAAAGGCGGTGATGGGACGG + Intergenic
1006338796 6:33434585-33434607 TTTCAAAGGCCGAGGTGGGAGGG - Intronic
1006401911 6:33822669-33822691 TGACGAATCCGGGGGTGAGAGGG - Intergenic
1006916413 6:37596811-37596833 TGTGAAATGTGGGGATGGGGAGG + Intergenic
1010999914 6:82576333-82576355 TGTCAGTTGCGGGTATGGGATGG - Intergenic
1011646032 6:89458935-89458957 TGTCAAATGTGGGGGTGGCAGGG - Intronic
1018561322 6:165103405-165103427 TGTGAAATGGGGGGGGGGGGTGG + Intergenic
1018591974 6:165435964-165435986 TTTCAAATGACTGGGTGGGAAGG + Intronic
1018961610 6:168453197-168453219 TGACAAATGCGGGCGGGGGTGGG + Intronic
1019054308 6:169212082-169212104 TGCCAGATGCTGGGGTGGAATGG + Intergenic
1019819781 7:3234052-3234074 AGTCAAATTCGGGAGAGGGAGGG + Intergenic
1021773871 7:24032407-24032429 TGTCAAATGAGGGGATTGTAAGG + Intergenic
1024409733 7:49026473-49026495 AGCCAAATGAGGAGGTGGGAGGG - Intergenic
1027319331 7:77002376-77002398 TGTCCCCTGCAGGGGTGGGAGGG + Intergenic
1030635568 7:111944631-111944653 GGTCATATGTGGGGTTGGGAAGG + Intronic
1031957859 7:127960350-127960372 TGGCAATAGCTGGGGTGGGACGG - Intronic
1033357223 7:140609928-140609950 TGTCAAATGCAGTAGTGAGAAGG - Intronic
1035131867 7:156661896-156661918 TTTCAAGTGTGGGGGTGGGGAGG + Intronic
1035546427 8:485276-485298 AGTGAAAGGCTGGGGTGGGAGGG - Intergenic
1038852600 8:31294837-31294859 TGTAAAAAGCCGGGGAGGGAAGG - Intergenic
1041558241 8:59184081-59184103 TTTTAAAGGAGGGGGTGGGAGGG - Intergenic
1041761980 8:61377104-61377126 TGTCATATACAGGGGTGGCATGG + Intronic
1042442867 8:68848363-68848385 TATTAAATGCTAGGGTGGGAGGG + Intergenic
1043754385 8:83984813-83984835 TGTAAAATGTGGGGGTGGTGAGG + Intergenic
1046797523 8:118389106-118389128 TGTGAAATGCTGGAGAGGGATGG - Intronic
1047246687 8:123152347-123152369 TGGCAGAGGCGGGGGTGGGCAGG - Intergenic
1049962115 9:746936-746958 TTTTAAAAGCGGGGGAGGGAGGG - Intergenic
1050853607 9:10321593-10321615 TTTTAAAAGCGGGGGTGGAATGG + Intronic
1052367248 9:27626598-27626620 TATGAAAGGCCGGGGTGGGAGGG - Intergenic
1053443834 9:38136463-38136485 TGTAAATTGAGGGGGTTGGATGG - Intergenic
1055272591 9:74578013-74578035 TGTAAAATGGGAGGGTGGGTAGG - Intronic
1056883955 9:90421766-90421788 TGGCAAATGGGGAGTTGGGAAGG + Intergenic
1057284873 9:93743883-93743905 TCTAAAATGCGGGGGGGGGGGGG - Intergenic
1057949876 9:99361292-99361314 TGGCAAAGGCAGGAGTGGGAAGG - Intergenic
1059518374 9:114916690-114916712 TATCAAATGAGGTGGTGGGCTGG - Intronic
1059552451 9:115243143-115243165 TCTCAAAGGCAGGGGTGGGAAGG - Intronic
1061171373 9:128957785-128957807 TGTAAAATGAGGGGCTGGGCAGG - Intronic
1061543829 9:131292249-131292271 TGTCAGAAGATGGGGTGGGAAGG + Intronic
1061623648 9:131827729-131827751 TGAAGAATGCGGGGGTGGAAGGG + Intergenic
1062385655 9:136310493-136310515 TGGCAGATGCAAGGGTGGGAAGG + Intergenic
1188349982 X:29116960-29116982 TATCAAATGAGGAGGTGGTATGG + Intronic
1189392523 X:40588338-40588360 TGTCAAATGTTGGGGGGGGGGGG - Intronic
1190273128 X:48882596-48882618 TATCAAATACTGGGGTGGGCCGG - Intergenic
1191853279 X:65601925-65601947 TGTCAGATGCTTGGGAGGGAAGG + Intronic
1192808331 X:74529098-74529120 TATAAAATGGGGTGGTGGGAGGG - Intronic
1193898685 X:87148067-87148089 TTTCAAATGCAGTGATGGGATGG + Intergenic
1196505660 X:116437975-116437997 AGGGAAAAGCGGGGGTGGGAGGG - Intronic
1198210358 X:134510506-134510528 TTTCTAATCCGGGGGTGGGCGGG + Intronic