ID: 946712621

View in Genome Browser
Species Human (GRCh38)
Location 2:222521930-222521952
Sequence CTATGGACAGATACCAGGTA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 114}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946712611_946712621 24 Left 946712611 2:222521883-222521905 CCACGCCATGGCGGCCACTGCCA 0: 1
1: 0
2: 1
3: 12
4: 170
Right 946712621 2:222521930-222521952 CTATGGACAGATACCAGGTAAGG 0: 1
1: 0
2: 0
3: 3
4: 114
946712612_946712621 19 Left 946712612 2:222521888-222521910 CCATGGCGGCCACTGCCATTGCC 0: 1
1: 0
2: 3
3: 31
4: 207
Right 946712621 2:222521930-222521952 CTATGGACAGATACCAGGTAAGG 0: 1
1: 0
2: 0
3: 3
4: 114
946712618_946712621 -9 Left 946712618 2:222521916-222521938 CCTCCTTATCTCTACTATGGACA 0: 1
1: 0
2: 0
3: 11
4: 138
Right 946712621 2:222521930-222521952 CTATGGACAGATACCAGGTAAGG 0: 1
1: 0
2: 0
3: 3
4: 114
946712609_946712621 28 Left 946712609 2:222521879-222521901 CCACCCACGCCATGGCGGCCACT 0: 1
1: 0
2: 0
3: 18
4: 226
Right 946712621 2:222521930-222521952 CTATGGACAGATACCAGGTAAGG 0: 1
1: 0
2: 0
3: 3
4: 114
946712610_946712621 25 Left 946712610 2:222521882-222521904 CCCACGCCATGGCGGCCACTGCC 0: 1
1: 0
2: 2
3: 20
4: 155
Right 946712621 2:222521930-222521952 CTATGGACAGATACCAGGTAAGG 0: 1
1: 0
2: 0
3: 3
4: 114
946712617_946712621 -8 Left 946712617 2:222521915-222521937 CCCTCCTTATCTCTACTATGGAC 0: 1
1: 0
2: 0
3: 16
4: 170
Right 946712621 2:222521930-222521952 CTATGGACAGATACCAGGTAAGG 0: 1
1: 0
2: 0
3: 3
4: 114
946712614_946712621 4 Left 946712614 2:222521903-222521925 CCATTGCCTTCACCCTCCTTATC 0: 1
1: 0
2: 5
3: 43
4: 457
Right 946712621 2:222521930-222521952 CTATGGACAGATACCAGGTAAGG 0: 1
1: 0
2: 0
3: 3
4: 114
946712615_946712621 -2 Left 946712615 2:222521909-222521931 CCTTCACCCTCCTTATCTCTACT 0: 1
1: 0
2: 0
3: 54
4: 460
Right 946712621 2:222521930-222521952 CTATGGACAGATACCAGGTAAGG 0: 1
1: 0
2: 0
3: 3
4: 114
946712613_946712621 10 Left 946712613 2:222521897-222521919 CCACTGCCATTGCCTTCACCCTC 0: 1
1: 0
2: 6
3: 45
4: 574
Right 946712621 2:222521930-222521952 CTATGGACAGATACCAGGTAAGG 0: 1
1: 0
2: 0
3: 3
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946712621 Original CRISPR CTATGGACAGATACCAGGTA AGG Exonic
902148649 1:14424652-14424674 GTAAGGACAGATACCAGGAAGGG + Intergenic
902754050 1:18537547-18537569 CTGGGGACTGATACCAGGAAAGG - Intergenic
904793201 1:33039204-33039226 CTATGCACAGGGACCAGGCAAGG + Intronic
906749822 1:48248782-48248804 CTACTGACAGACACCAGGTGAGG + Intergenic
913383043 1:118231019-118231041 CTATGGAAAGATCCTTGGTATGG + Intergenic
915993704 1:160543296-160543318 CTAAGGCCAAGTACCAGGTAGGG + Intronic
917762914 1:178183102-178183124 CCATGGACTGGTACCAGTTAGGG + Intronic
1063445683 10:6113695-6113717 CTTTGGGCAGATCCCACGTAAGG + Intronic
1064394781 10:14973154-14973176 TTATGGACAGAGGCCAGGTGTGG - Intronic
1068504413 10:57881871-57881893 CAATAGACAGATAGTAGGTAGGG + Intergenic
1069151099 10:64961020-64961042 CTATTGACAAACACCAGGTCTGG + Intergenic
1074490869 10:113938470-113938492 GTAGGGACAGATCCCAGGAATGG - Intergenic
1078254984 11:9651083-9651105 CTAAGGTCAGAAACAAGGTAAGG - Intergenic
1081936933 11:46911296-46911318 CTGTTGACAGCTTCCAGGTAGGG - Intronic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1084131226 11:67136778-67136800 CCATGTTCAGATACCATGTAGGG + Intronic
1086054000 11:82626817-82626839 CTATGGAAGGATACTTGGTATGG + Intergenic
1090941744 11:131393398-131393420 GAATGGACAGATGGCAGGTAAGG + Intronic
1092732815 12:11550289-11550311 GTATGGACAGAGGCCAGGTCAGG + Intergenic
1096597524 12:52706063-52706085 CACTGAACAGATACCATGTACGG - Intergenic
1100779851 12:98012459-98012481 AAATGGACAGATACCATGTTTGG - Intergenic
1102491661 12:113293057-113293079 AGATGGAGAGATACCAGGTGAGG + Exonic
1102542643 12:113633726-113633748 ATATGGACTGAGACCAGGTGAGG + Intergenic
1105812052 13:24004322-24004344 CTTTGAACAGATACCATTTACGG + Intronic
1106194806 13:27483933-27483955 CTATGAACAGAGACCAGTCAAGG + Intergenic
1113560878 13:111279662-111279684 CAATGGAAAGATACCAGAAAGGG - Intronic
1116031561 14:39578944-39578966 CTCTGGACAGACATCTGGTAAGG - Intergenic
1119149426 14:72344785-72344807 CCATGGACAGATTTTAGGTAGGG + Intronic
1125672180 15:41481582-41481604 CCATGGCCAGGTACCAGGGAGGG + Exonic
1127067316 15:55253568-55253590 CTGAGGACAGAGACAAGGTATGG - Intronic
1127091329 15:55470411-55470433 CTAGGGAAAGATACCGGGGAAGG + Intronic
1127870582 15:63069527-63069549 CTATTGCCAGAAACCATGTATGG + Intronic
1130285207 15:82549040-82549062 CTAAGGTCAGAGACCAGGTCAGG - Intronic
1130655217 15:85787832-85787854 CTGTGGACAGATACAAAGGAGGG + Intronic
1130894991 15:88163056-88163078 CTAGGGAGAGATAGGAGGTAGGG - Intronic
1130916103 15:88306021-88306043 CTATGGTCAAATATCAGATAGGG - Intergenic
1131765969 15:95676387-95676409 ATATGGATAGAGACCAGGGAAGG + Intergenic
1137682201 16:50358700-50358722 CTAGGTAAAGATACTAGGTAGGG - Intronic
1141356256 16:83349522-83349544 ACAGGGACAGATACCAGGTAAGG + Intronic
1143055473 17:4158834-4158856 CTAGGGACAGATAAGAGGGAAGG - Intronic
1143112830 17:4562293-4562315 CTAGAGACAGAAACCAGCTAAGG - Intergenic
1143266822 17:5644219-5644241 CTATGGAAAGAAACCAGGCCTGG + Intergenic
1144155137 17:12492990-12493012 CCATGGACAGAGACAAGGGAGGG + Intergenic
1146583860 17:34065020-34065042 CTCTGGATAGATACCCAGTAGGG - Intronic
1146617761 17:34370351-34370373 CTATGGACAGAGAGAAGGTGAGG + Intergenic
1146681274 17:34810170-34810192 TTAGGGAAAAATACCAGGTATGG - Intergenic
1148783843 17:50135661-50135683 CAAGGGACAGATGGCAGGTAAGG + Intronic
1152515890 17:80824725-80824747 CCATGGACTGATTCCTGGTAAGG - Intronic
1152610717 17:81313920-81313942 CTGTGAACAAAGACCAGGTAAGG + Exonic
1163392008 19:17036773-17036795 GTATGGACAGACCCCAGGTGAGG - Intergenic
1164118464 19:22244432-22244454 CTATTGGCTGATTCCAGGTACGG + Intergenic
1166128857 19:40733403-40733425 CTATAGCCAGATCCCAGGCAGGG + Intronic
927185114 2:20476748-20476770 CTATAGAAAGGCACCAGGTATGG - Intergenic
928133211 2:28668457-28668479 CAAAGGACAGACAACAGGTAGGG - Intergenic
929401980 2:41594332-41594354 ATATGGACAGAGACCAGGCTGGG - Intergenic
930861043 2:56073012-56073034 CTATGGACATAGAACTGGTAAGG - Intergenic
933488529 2:82953504-82953526 CTATGTATAGATACCAGTTCTGG - Intergenic
937896402 2:126979619-126979641 GTATGTACAGAGCCCAGGTAAGG + Intergenic
946712621 2:222521930-222521952 CTATGGACAGATACCAGGTAAGG + Exonic
947103284 2:226644456-226644478 GAATGGACAGAGACCAGGCAGGG - Intergenic
947747022 2:232513081-232513103 CTATGTCCAGCTACCAGGCATGG - Intergenic
1179017672 21:37607057-37607079 CTATGGCCAGATCCCAGCAATGG - Intergenic
1181910632 22:26235565-26235587 ATATGGACACATTCCAGGAAGGG + Intronic
1182713721 22:32338830-32338852 CTCTGGATAGATGCCAGGCAGGG - Intergenic
950582368 3:13870937-13870959 CAATGGGCAGGTACCAGGCAAGG - Intronic
950611949 3:14132610-14132632 CCATGGGCAGAGACCACGTAAGG - Intronic
954975060 3:54685691-54685713 CCATGAACAGTTACTAGGTAGGG - Intronic
961134046 3:124493911-124493933 CTATGTCCAGAGTCCAGGTAAGG + Intronic
962553567 3:136523068-136523090 CTTTGGATAGATACCCAGTAAGG + Intronic
962716684 3:138132715-138132737 TTATGGACAGAGACCCTGTAAGG + Intergenic
963143298 3:141965992-141966014 CTAGGGACAGACACCAAGTTAGG - Intronic
969340390 4:6536905-6536927 ATATGGAAAGATATCAGGTCAGG + Intronic
972581552 4:40399799-40399821 CCATGAACAGATGCCAGGTTAGG + Intergenic
976342701 4:83963168-83963190 ATATGGTTTGATACCAGGTATGG - Intergenic
984660932 4:182374609-182374631 CAATGGAAAGATATCATGTAGGG - Intronic
985054050 4:186020542-186020564 ATATGGACAGCAACCGGGTAAGG + Intergenic
985658824 5:1145487-1145509 CTGTGGGCAGATTCCAGGAAGGG - Intergenic
989484872 5:41977727-41977749 ATATGGACAGCGACCAGGCATGG - Intergenic
991012372 5:61897831-61897853 CCAAGGTCACATACCAGGTATGG + Intergenic
992490133 5:77234640-77234662 CTATGGAAAGGTACTATGTAGGG - Intronic
995973304 5:118000123-118000145 CTATGGACAAATACAGTGTAAGG - Intergenic
996842612 5:127864358-127864380 ATATGCACGGATAGCAGGTAGGG - Intergenic
997821821 5:137073064-137073086 CTATGCACAGAAACAAGGGAAGG + Intronic
998167918 5:139855088-139855110 CTCTGGACAGAGAAGAGGTAGGG - Intronic
1005696206 6:28354980-28355002 CTATGGTTTGATACCAGGTGTGG - Intronic
1006167904 6:32076058-32076080 CTATGTACAGGTACCAGGCTGGG + Intronic
1007053865 6:38861830-38861852 ACATAGACAGAAACCAGGTAAGG - Intronic
1009785257 6:68328906-68328928 AAATGGTCATATACCAGGTATGG + Intergenic
1012517751 6:100082210-100082232 CTATGGACTGGTACAAGGTTGGG - Intergenic
1012708742 6:102570713-102570735 CTAGGGAGAGATACCAGTTAGGG - Intergenic
1018291380 6:162295436-162295458 CTGTGGTCTGATACCACGTAAGG + Intronic
1020269748 7:6587520-6587542 CTATGGTCATATACCATTTACGG + Intronic
1023538653 7:41240831-41240853 CTTTTGACAGATACCAGGCCTGG + Intergenic
1026242298 7:68587143-68587165 CTGTGGACAGGTACAAGGAAAGG - Intergenic
1027366124 7:77460190-77460212 CTATGGAAAGGTACCAGCTTGGG + Intergenic
1027909040 7:84224811-84224833 CTATGTAGAGTTACCAGCTATGG - Intronic
1032765139 7:134984536-134984558 CTATGGAGAGAAATCAAGTAGGG - Intergenic
1035184809 7:157118157-157118179 TTATGGACATATACCAGAAAGGG - Intergenic
1039694229 8:39893473-39893495 CTCTGAACTGATAACAGGTAAGG + Intergenic
1040976114 8:53196010-53196032 CTATGGAGAGGTACCAGCTCAGG + Intergenic
1043719046 8:83521934-83521956 CTGTCGAGAGATACCAGGGAAGG + Intergenic
1045373307 8:101546879-101546901 CTATTCTGAGATACCAGGTAGGG + Intronic
1047745007 8:127838307-127838329 CTATGGACAGATACTGGTAATGG + Intergenic
1055399890 9:75912059-75912081 CTATGGATAGAGAACAGGAAAGG + Intronic
1058654187 9:107204753-107204775 ATAGAGCCAGATACCAGGTACGG - Intergenic
1059670607 9:116488007-116488029 AGATGGACAGAGACCAGCTAAGG + Intronic
1060106222 9:120875196-120875218 CTCTGGACAGATCTCAGGTTAGG - Intronic
1060194483 9:121614684-121614706 CTATGGGCAGAGACCAAATAGGG - Intronic
1062140986 9:134959117-134959139 CTATGGACAGTCACGAGGGAGGG - Intergenic
1186232878 X:7475324-7475346 GTCTGAACAGATACCAGGGAAGG - Intergenic
1192218006 X:69177390-69177412 CTATTGTTATATACCAGGTAGGG + Intergenic
1195066670 X:101243764-101243786 CTATGGACAAAAAGCAGGGAAGG + Intronic
1197024058 X:121726224-121726246 CAAAGAACAAATACCAGGTAAGG - Intergenic
1197102944 X:122678148-122678170 CTCTGGGTAGATACCTGGTAGGG - Intergenic
1197610301 X:128630954-128630976 CACTGGACATCTACCAGGTATGG - Intergenic
1202248412 Y:22843099-22843121 ACATAGACAGAAACCAGGTAGGG - Intergenic
1202401400 Y:24476847-24476869 ACATAGACAGAAACCAGGTAGGG - Intergenic
1202469381 Y:25193239-25193261 ACATAGACAGAAACCAGGTAGGG + Intergenic