ID: 946716784

View in Genome Browser
Species Human (GRCh38)
Location 2:222561281-222561303
Sequence CTGCAGGGGCAGATGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 1, 2: 5, 3: 38, 4: 431}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946716784_946716790 -4 Left 946716784 2:222561281-222561303 CCAGCCTTCATCTGCCCCTGCAG 0: 1
1: 1
2: 5
3: 38
4: 431
Right 946716790 2:222561300-222561322 GCAGAGCAGTGGCTGTCAGCCGG 0: 1
1: 0
2: 4
3: 44
4: 407
946716784_946716791 2 Left 946716784 2:222561281-222561303 CCAGCCTTCATCTGCCCCTGCAG 0: 1
1: 1
2: 5
3: 38
4: 431
Right 946716791 2:222561306-222561328 CAGTGGCTGTCAGCCGGATGCGG 0: 1
1: 0
2: 3
3: 47
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946716784 Original CRISPR CTGCAGGGGCAGATGAAGGC TGG (reversed) Intergenic
900117578 1:1035068-1035090 CTGGAGGGGCAGAGAAAAGCAGG + Intronic
900310989 1:2033028-2033050 GGGCAGGAGCAGATGAAGGCGGG + Intergenic
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
900625040 1:3604104-3604126 ACGAAGGGGCAGACGAAGGCTGG + Intronic
900740077 1:4325758-4325780 CTGCAGGGGCAGCCTGAGGCTGG - Intergenic
900896422 1:5486100-5486122 CTGCTTGGACAGGTGAAGGCTGG - Intergenic
902381004 1:16052175-16052197 CTGCAAGGGCAGAGTCAGGCAGG - Intronic
902545407 1:17186557-17186579 CTGTAGGGGGACATGGAGGCTGG + Intergenic
903261230 1:22132787-22132809 CTGCTGTGCCAGATGAAGGCAGG - Intronic
903372283 1:22844401-22844423 CTGCAGGGGCAGGGGCTGGCAGG + Intronic
903501907 1:23805123-23805145 CTGTAGGCCCAGATGTAGGCAGG - Intronic
903512609 1:23887427-23887449 ATGCTGGGGCTGATGGAGGCTGG + Intronic
903846237 1:26281173-26281195 CTTCATGGCCAGGTGAAGGCTGG - Exonic
904193393 1:28765110-28765132 CTGCTGGGGAGGCTGAAGGCAGG - Intronic
904503953 1:30935608-30935630 TGGCAGTGGCAGTTGAAGGCTGG - Intronic
904647394 1:31978069-31978091 CTGCAGGGGCAGATGGGAGATGG + Intergenic
904654036 1:32029073-32029095 ATGGAGAGGCAGATGAAGGGAGG - Intronic
906058062 1:42931207-42931229 CTGCAGGGGGAGATGCAGCCTGG + Intronic
906150167 1:43582963-43582985 CTGTGTGGGCAGATGAAGGTTGG + Intronic
906539384 1:46573404-46573426 GTGCAGGGGCAGACACAGGCAGG + Intronic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907427695 1:54391252-54391274 CTGGAGGGGCAGAAAAAAGCCGG + Intronic
907866236 1:58402110-58402132 CTCCAGGAGCATATGAATGCAGG - Intronic
907943741 1:59113464-59113486 CTGCTGGGGCAGGTGAAGTGTGG - Intergenic
909085460 1:71165505-71165527 CATCAGGGGCAGAGCAAGGCAGG - Intergenic
909526003 1:76623351-76623373 ATGCAGGGGAAAATAAAGGCAGG - Intronic
910098233 1:83548510-83548532 CAGCAGGGCCAGATGACGGAAGG + Intergenic
912565776 1:110586177-110586199 CTGCAGGAGCAGAAGAAGCAAGG - Intergenic
912567372 1:110597940-110597962 CAGCAGGGACAGATGGAGGTAGG - Intronic
912595947 1:110875754-110875776 CTGCTGGGGCAGAGGAGGGAAGG + Intronic
912778658 1:112523876-112523898 CTGCAGGGCTAGGTTAAGGCTGG - Exonic
912861444 1:113217404-113217426 CTGCAGAAGCAGAAGAAAGCTGG - Intergenic
913366799 1:118048012-118048034 CTGCAGAGTCAGGTGCAGGCTGG + Intronic
914339357 1:146745842-146745864 CTGTAGGGGCAGAGTAAGGCTGG - Intergenic
914827359 1:151145666-151145688 CTGCAGGCGCAGACGAAGAGGGG + Intronic
915732856 1:158066611-158066633 CTACAGGAGCACATGGAGGCAGG - Intronic
915893438 1:159792301-159792323 CTCCAGGGACAAAGGAAGGCTGG + Intergenic
916123395 1:161549112-161549134 CTCCTGGGGCAGAGGAGGGCAGG - Intronic
916133287 1:161630470-161630492 CTCCTGGGGCAGAGGAGGGCAGG - Intronic
916564150 1:165958629-165958651 ATGCAGGGCAAGATGCAGGCAGG + Intergenic
916713317 1:167431111-167431133 CTGCAGGGGCATGGGAAGGTGGG - Exonic
917727059 1:177838324-177838346 CTGCAGTGGCTATTGAAGGCAGG + Intergenic
917765432 1:178211499-178211521 CTGTAGAGGCAGATCAAGGGAGG - Intronic
918363252 1:183780501-183780523 GTGCTGGGGCAGAAGAGGGCAGG - Intronic
918982111 1:191575794-191575816 CTGCAGAGAAAGATGAAGGGAGG + Intergenic
919325402 1:196100400-196100422 CTGAAAGGAAAGATGAAGGCTGG + Intergenic
919717516 1:200794693-200794715 CAGCAGAGCCAGATTAAGGCAGG - Intronic
920034408 1:203056558-203056580 CTGCAGAGGCAGAGGAAGGGAGG - Intronic
920091339 1:203455286-203455308 CCTCAGAGGCAGATGAGGGCTGG - Intergenic
920438005 1:205960680-205960702 CTGCAGGGGCTCTTGAGGGCTGG + Intergenic
920615436 1:207487836-207487858 CTGCAGGTGCAGATGAAGGCAGG + Intronic
920648045 1:207817631-207817653 ATGCAGGGTCTGATGAAGGAGGG + Intergenic
920732128 1:208497139-208497161 CTGCAGGGACACATGCAGACAGG + Intergenic
922703965 1:227779228-227779250 CTCATGGGTCAGATGAAGGCCGG + Intronic
922741122 1:228014755-228014777 ATGCAGGGGAAGAAGGAGGCTGG - Intronic
1062925746 10:1314413-1314435 CTGCAGGGGCAGACCAGGGAGGG - Intronic
1063718927 10:8558753-8558775 CTGCAGGGGTAGAGAAAGGGAGG - Intergenic
1064297309 10:14090066-14090088 CCGCAGGGGCAGATGGCTGCTGG + Intronic
1066005706 10:31144429-31144451 CTGGAGAGGCAGCTGCAGGCAGG - Intergenic
1066369865 10:34811425-34811447 CTGCAGGGGCAGATGGGCTCTGG - Intronic
1066489702 10:35882857-35882879 CTGGAGGGACAGATGCAGACAGG + Intergenic
1067229275 10:44395527-44395549 CAGCAGGAGCAGCTGAGGGCAGG + Intergenic
1070688968 10:78510757-78510779 GTGCAGGGGCAGCTGCAGGCAGG - Intergenic
1070811199 10:79298942-79298964 CTGCATGCTCAGAGGAAGGCAGG - Intronic
1070969210 10:80549686-80549708 CTGCTGGGCCTGAGGAAGGCAGG - Intronic
1071985754 10:91048601-91048623 CTGCAGTGGCAGAAGACTGCTGG + Intergenic
1072198130 10:93134641-93134663 CTTCATGGGCAGGTGAAGACAGG + Intergenic
1072449893 10:95531575-95531597 CTTCAGGGGCAAAACAAGGCTGG + Intronic
1073300064 10:102465747-102465769 CTGCTGGGGCAGATTGAGGGTGG + Intronic
1073568745 10:104558050-104558072 CTGCAGGTGCTGGTGAAGGATGG + Intergenic
1074434683 10:113424088-113424110 CTGCAGGTGCTGGGGAAGGCTGG + Intergenic
1074532207 10:114305495-114305517 CTGCAGGAGGAGATGCAGGAGGG + Intronic
1075330100 10:121567657-121567679 CAGCAGTGGCAGAGGAGGGCTGG + Intronic
1075566229 10:123506440-123506462 CTGCATGGGAAGATGCAGGAAGG - Intergenic
1076404622 10:130203735-130203757 CGGGAGGGGCAGGTGGAGGCGGG - Intergenic
1076404630 10:130203754-130203776 CGGGAGGGGCAGGTGGAGGCGGG - Intergenic
1076404638 10:130203773-130203795 CGGGAGGGGCAGGTGGAGGCGGG - Intergenic
1076727827 10:132421620-132421642 CTGCTGGGGCAGAGGCTGGCTGG - Intergenic
1076799309 10:132813308-132813330 CTGCAGGGGCAGGTGTGTGCAGG - Intronic
1076799320 10:132813355-132813377 CTGCAGGGGCAGGTGTGTGCAGG - Intronic
1076799331 10:132813401-132813423 CTGCAGGGGCAGGTGTGTGCAGG - Intronic
1076799342 10:132813447-132813469 CTGCAGGGGCAGGTGTGTGCAGG - Intronic
1076799356 10:132813510-132813532 CTGCAGGGGCAGGTGTGTGCAGG - Intronic
1076799366 10:132813540-132813562 CTGCAGGGGCAGGTGTGTGCAGG - Intronic
1076799376 10:132813570-132813592 CTGCAGGGGCAGGTGTGTGCAGG - Intronic
1076799386 10:132813600-132813622 CTGCAGGGGCAGGTGTGTGCAGG - Intronic
1076799396 10:132813630-132813652 CTGCAGGGGCAGGTGTGTGCAGG - Intronic
1076799406 10:132813660-132813682 CTGCAGGGGCAGGTGTGTGCAGG - Intronic
1076799416 10:132813690-132813712 CTGCAGGGGCAGGTGTGTGCAGG - Intronic
1076852959 10:133102139-133102161 CTGCAGGGCCACACGAATGCCGG + Intronic
1077024589 11:433578-433600 CCACAGCGGCAGATGAAGGGAGG - Intronic
1077104673 11:836997-837019 CTGCAGGGGCACATGGGGTCAGG + Intronic
1077228416 11:1448242-1448264 CTGCAGGAGCTGAGGAGGGCAGG + Intronic
1077368595 11:2171287-2171309 CAGCTGGGGCAGAGGGAGGCAGG + Intronic
1077392375 11:2306084-2306106 CAACAGGGGCAGGTGAAGACCGG - Intronic
1077434509 11:2532351-2532373 ACGCAGGGGCAGCTGAAGCCGGG - Intronic
1077537885 11:3133233-3133255 CTGCAGTGAAAGCTGAAGGCTGG + Intronic
1077608584 11:3628818-3628840 ATGCAGGGGCAGAGGCAGGATGG + Intergenic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1077898590 11:6473112-6473134 CTGCAGGGACAGATGGTTGCAGG - Intronic
1078050361 11:7960500-7960522 CTGCAGGGGCAGATGGAGAGAGG - Exonic
1078574044 11:12483654-12483676 CTGTAGCTGCAGATGAATGCAGG + Intronic
1079450773 11:20598269-20598291 CTGCAGTGGCAGATTGCGGCGGG - Intergenic
1079543363 11:21603020-21603042 CTGCAAGGGCTGATAAAGACAGG + Intergenic
1080239404 11:30109466-30109488 GTGCAGGGCCAGAAGCAGGCAGG - Intergenic
1080646856 11:34193810-34193832 CTGCAGGAGTAGATGAAAGGAGG + Intronic
1083201514 11:61123760-61123782 CGGCAGGTGCAGCTGAGGGCAGG - Intronic
1083614471 11:64019409-64019431 GTGCTGGGGCAGAGGAGGGCCGG - Intronic
1083865074 11:65449239-65449261 CTGCAGGGCCAGAGAAAGGGGGG + Intergenic
1084063512 11:66690419-66690441 GTGCTGGGAAAGATGAAGGCAGG + Intronic
1084475377 11:69385771-69385793 ATGCAGAGGAAGATTAAGGCTGG - Intergenic
1084642383 11:70433503-70433525 GGGCAGGGGCAGAGGAAGGGAGG + Intronic
1084936460 11:72589697-72589719 CTGCAGGGGCGGTTGAGGCCGGG - Intronic
1085643454 11:78207785-78207807 CTGCTGGGGCAGGAGAAGGCGGG + Intronic
1086220576 11:84438031-84438053 CTGCAGGGGCAGATTCATGGTGG - Intronic
1087013382 11:93533782-93533804 CTGTCGGGGCAGATGAGGGTGGG - Intronic
1088619993 11:111671986-111672008 CTGCAGCAGCAGAAGATGGCTGG - Intronic
1089200037 11:116719051-116719073 CTGGAGAGGCAGATAAAGGGAGG - Intergenic
1089346574 11:117795403-117795425 CTGCGGGGGCGGAGGGAGGCAGG + Intronic
1089391226 11:118103242-118103264 CTGCAGTGGCAGGTGAGTGCAGG + Exonic
1090075360 11:123577344-123577366 CTGCAGCGGCAGATGGAGAGAGG - Intronic
1090273803 11:125405728-125405750 CAGGAGGGGCAGAGCAAGGCAGG - Intronic
1090392005 11:126394817-126394839 CTGCAGGGGCGGATGGTGGGGGG + Intronic
1091306355 11:134538787-134538809 ATGCAGGGGGAGAGGCAGGCTGG + Intergenic
1091498053 12:989984-990006 CTGAAGGGGGAGATGACAGCAGG + Intronic
1091994799 12:4985002-4985024 TTGCAGTGGCAGATGATGGCAGG + Intergenic
1092106841 12:5927363-5927385 CTACAGAGGCAGATGAAGAAGGG + Intronic
1096465389 12:51845716-51845738 CGGCAGGGGGAGGGGAAGGCAGG + Intergenic
1097016829 12:55993150-55993172 CTGCAGGGGTATATGGTGGCTGG - Exonic
1097232955 12:57523119-57523141 CGGCGGGGGCAGGTGAGGGCGGG - Intronic
1101727025 12:107396160-107396182 GTGGAGAGGCAGAGGAAGGCTGG - Intronic
1102068695 12:109999773-109999795 CTGCAGGGCCAGGTGAGGGGCGG + Exonic
1102920044 12:116785025-116785047 TGGCAGGGGCAGAGGCAGGCTGG - Intronic
1103673523 12:122637931-122637953 CTGCAGTCGCAGATGGAGTCTGG + Intergenic
1103811893 12:123621428-123621450 GTGCAGGGGAGGATGAAGACAGG + Exonic
1103955445 12:124573961-124573983 CTGAAGGAGCAGAGGAAGCCGGG - Intergenic
1104700028 12:130895899-130895921 CTGCAGGGGCTGAGGAGGGCAGG + Intergenic
1104748697 12:131224878-131224900 CTGGAGGGGCAGAGCCAGGCAGG + Intergenic
1104784427 12:131440686-131440708 CTGGAGGGGCAGAGCCAGGCAGG - Intergenic
1104910396 12:132237628-132237650 CTGCAGAGGCAGCTGTGGGCAGG - Intronic
1106553629 13:30791922-30791944 CTGCATGGTCAGATGCAGACAGG - Intergenic
1107873546 13:44768903-44768925 CTGGAGGGGCAGACTATGGCAGG + Intergenic
1108442102 13:50465197-50465219 TTGCAGGGGCAGATGGTGGTGGG + Intronic
1110760698 13:79227455-79227477 CTTCAGTGGCAGTTGAAGGCAGG + Intergenic
1112941045 13:104862075-104862097 CCGGATGGGCAGATGATGGCTGG + Intergenic
1113098738 13:106694566-106694588 CTGCACAGGCAGAAGAAGGAAGG - Intergenic
1113731815 13:112647078-112647100 TTGCAATAGCAGATGAAGGCCGG - Exonic
1113929043 13:113956840-113956862 CTGCAGGGCGAGAGGAGGGCAGG + Intergenic
1116671995 14:47854611-47854633 CTGAAGGGGCAAATGAAAGGAGG + Intergenic
1117019081 14:51550632-51550654 GTGCAGAGGCAGAGGAAGGGCGG + Intronic
1118276240 14:64388274-64388296 CTGCAGGGGGAGAAGCGGGCAGG + Intronic
1118315444 14:64723094-64723116 TTGCAGGTGCAGAGGCAGGCAGG - Intronic
1118501014 14:66362741-66362763 CTTCATGTGGAGATGAAGGCAGG - Intergenic
1120015629 14:79470216-79470238 CACAAGGGGGAGATGAAGGCAGG + Intronic
1120017312 14:79488535-79488557 AAGCTGGGGCAGAAGAAGGCAGG + Intronic
1121504702 14:94467989-94468011 CTGGATGGGTAGATGAAGGGTGG + Intronic
1121692784 14:95889762-95889784 CTGCAGGTGCACAGGAAGGGAGG - Intergenic
1121719151 14:96097214-96097236 CTGCTGGGGCAGGTGCATGCTGG + Intergenic
1122232701 14:100314811-100314833 GGGCAGTGGCAGATGAAGGAGGG - Intergenic
1122461668 14:101900861-101900883 CTGCAGTGGCAGCTGTAGCCAGG - Intronic
1122506950 14:102237735-102237757 CTACAGGGGCAAAGGAAGGAGGG - Intronic
1122812973 14:104298038-104298060 ATGCAGGGGCAGGTGGAGGAAGG - Intergenic
1122891750 14:104735247-104735269 CTGGTGGGGCAGGTGGAGGCTGG - Intronic
1122932117 14:104938558-104938580 CACCACTGGCAGATGAAGGCAGG - Exonic
1123145848 14:106129407-106129429 AGGCAGGTGCAGATGGAGGCTGG - Intergenic
1202856515 14_GL000225v1_random:54585-54607 CTGCAGGGGCATGGGCAGGCCGG - Intergenic
1202857469 14_GL000225v1_random:59851-59873 CTGCAGGGGCACGGGCAGGCCGG - Intergenic
1125968857 15:43895714-43895736 CCGCAGGGGCAGATGACAGCTGG + Intronic
1127618574 15:60711069-60711091 CTGCAGGGGCAGAGCAAGGCTGG - Intronic
1128320688 15:66691762-66691784 CTGCAGGGGTGGATCCAGGCTGG + Intergenic
1128524935 15:68406012-68406034 CTGCTGGGTCAGATGCAGGAAGG - Intronic
1128749809 15:70140794-70140816 CTGCAGCTGGAGAAGAAGGCAGG + Intergenic
1129170578 15:73805061-73805083 CTGCAAGGGGAGAGGGAGGCAGG + Intergenic
1129291169 15:74568995-74569017 CAGCAGAGGCAGATGGAGGGTGG - Intronic
1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG + Intronic
1129519741 15:76178142-76178164 CTGCTGGGACAGAGGAAGCCTGG + Intronic
1130352762 15:83106765-83106787 CTGCAGGGCCCAATGCAGGCTGG + Intergenic
1131449546 15:92527985-92528007 TTGCTGGGGCAGATGAAGTCTGG - Intergenic
1132684290 16:1155836-1155858 CTCCAGGGGGAGAGGAGGGCTGG + Intronic
1132996878 16:2828059-2828081 CTGGAGGGGCTGGTGAGGGCTGG - Intergenic
1133240241 16:4409807-4409829 CTGAAGGGGCCTCTGAAGGCAGG + Intronic
1135007497 16:18839592-18839614 CTGGAGGGACAGAGGAAGGAAGG + Intronic
1135661594 16:24301743-24301765 CTGCATGCGAAGATGAAGGAAGG - Intronic
1135777352 16:25268513-25268535 GAGCAGGTGCAGATAAAGGCTGG - Intergenic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1136477303 16:30521513-30521535 CTGAAGGAGAAGATGGAGGCTGG + Exonic
1138390505 16:56667199-56667221 CTACAGGGACAAAGGAAGGCCGG + Intronic
1138455232 16:57117139-57117161 CCGCAGGGGCAGGAGAAGGCCGG + Intronic
1139569218 16:67800228-67800250 CTGCAGGAGCAAGGGAAGGCTGG + Intronic
1139801112 16:69523701-69523723 CTCCAGGGGCAGATCAAAGCCGG + Intergenic
1139994918 16:70971507-70971529 CTGTAGGGGCAGAGTAAGGCTGG + Intronic
1141064464 16:80902685-80902707 CTGCAAGGGCAGAGGAGAGCAGG + Intergenic
1141125031 16:81395163-81395185 CAGCTGGGGAAGATGCAGGCTGG - Intergenic
1141352022 16:83306707-83306729 CTGGAGGGGTAGGTGAGGGCTGG + Intronic
1141962981 16:87421656-87421678 CTGCAGGGACGGCTGAAAGCTGG + Intronic
1142135592 16:88450601-88450623 ATGCAGGGGCAGATGGAAACTGG + Intergenic
1142742715 17:1940523-1940545 CTCCTTGGGCAGATGGAGGCAGG - Intronic
1142857102 17:2737216-2737238 TTCCAGGGGCAGGTGAAGGCAGG - Intergenic
1143649756 17:8256244-8256266 CTGCAGGGGGCGATGCAGGGAGG - Intronic
1144838459 17:18171026-18171048 CTGGAGCTGCAGATGAAGGAAGG - Intronic
1144847766 17:18228930-18228952 CTGGATGGGCAGAGGCAGGCAGG + Intronic
1146118822 17:30170876-30170898 CTGCTGGTGCAGATGTAGGCTGG - Intronic
1146786853 17:35728635-35728657 GAGCAGGGGCAGAGGTAGGCAGG + Intronic
1146952819 17:36918625-36918647 TTGAGAGGGCAGATGAAGGCTGG - Intergenic
1147246611 17:39125268-39125290 CTGCAAGGGGAGATCCAGGCTGG + Intronic
1147583490 17:41639416-41639438 CTCCAGGGGCAGATGAGGCCAGG + Intergenic
1147995822 17:44359878-44359900 GTGCAGGGGCAGGTGGAGGGGGG - Intronic
1147997887 17:44371107-44371129 GAGAAGGGGCAGAGGAAGGCTGG - Intergenic
1148477605 17:47939497-47939519 CTGCAGGGGCTTAGGAGGGCAGG + Intergenic
1148778528 17:50109208-50109230 CTGCAGGGACTGATGCAGGGAGG - Intronic
1149588817 17:57812118-57812140 CACCAGGGGCAGGGGAAGGCAGG - Intergenic
1150209623 17:63435007-63435029 CAGCTGGGGAAGCTGAAGGCAGG + Intronic
1151961005 17:77405619-77405641 ATGCAGGGACAGACGAGGGCAGG + Intronic
1152270695 17:79323014-79323036 GTGCTGGGGGACATGAAGGCTGG + Intronic
1152435372 17:80273218-80273240 CTGTAACGGCAGATGAAGGAAGG - Intronic
1152704869 17:81838072-81838094 TTGCAGGGGCAGAGGAGAGCTGG + Intergenic
1153579475 18:6557720-6557742 CTCCAGGGCCAGAGGAAAGCCGG + Intronic
1153721033 18:7903358-7903380 CTGCAGGGACAGCTGAGGGGTGG - Intronic
1153772350 18:8426071-8426093 CTGCTGGGGCAGGTGAGGGCGGG - Intergenic
1153810881 18:8750533-8750555 CTGGAGGTGCAGAGGAAGGAAGG + Intronic
1155186076 18:23387490-23387512 CTGCAGAGGCTGCTGAGGGCGGG - Intronic
1155320509 18:24614184-24614206 CTGCAGGGCCAGCTGTAGGAGGG + Intergenic
1156462621 18:37329899-37329921 CTGGTGGGGCAGATGAAGATGGG - Intronic
1160006002 18:75069437-75069459 GTGGAGGTGCAGCTGAAGGCGGG - Intergenic
1160222264 18:76985883-76985905 CTGCTGGGGCTGATGAGGCCAGG - Intronic
1160318200 18:77867316-77867338 CTGCAGGTGGAGAGGAAGGTGGG - Intergenic
1160984589 19:1832452-1832474 CTGCAGGGACAGCGGGAGGCCGG + Intronic
1161000646 19:1909176-1909198 CTGTGGGGGCAGATGCAGGTGGG + Intronic
1161025287 19:2033953-2033975 CTGCTGGGGGAGGTGAAGGGTGG - Intronic
1161041941 19:2115004-2115026 CTTCAGAGGCAGATGCAGGTTGG - Intronic
1161073111 19:2272078-2272100 GTGCAGGGACAGATGAGGGAGGG + Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161516903 19:4701753-4701775 TTCCAGGGCCAGACGAAGGCAGG - Intronic
1161666138 19:5578254-5578276 CTGGAGGCGCAGGTGGAGGCTGG - Intergenic
1161979384 19:7622662-7622684 CTGCAGGGGCAGACAGTGGCCGG + Intronic
1162337045 19:10068174-10068196 CTGCAGGAGATGATGGAGGCCGG + Intergenic
1162570363 19:11468225-11468247 TGGCAAGGGGAGATGAAGGCAGG - Intronic
1163650363 19:18514118-18514140 CTGCCAGGTCAGATGGAGGCGGG + Intronic
1164161550 19:22628506-22628528 CTGCAGGGGCACATGAGGGCTGG - Intergenic
1166731001 19:45059021-45059043 TTGAAGGGGCAGATGAACGGAGG - Intronic
1167409306 19:49335659-49335681 CCACAGGGGAAGATGAGGGCTGG - Intronic
1167619897 19:50554988-50555010 CTGCAGGGGCTGAGGAAGGGTGG - Intronic
1167637887 19:50666183-50666205 CTGCAGCGGCAGAGGTAAGCGGG - Exonic
925084477 2:1097229-1097251 GTGCAGGTGCAGATGCAGGGAGG - Intronic
925302356 2:2826351-2826373 CTGCAGGGGCCGGTGAGGGGAGG - Intergenic
926621013 2:15047519-15047541 GGGCCCGGGCAGATGAAGGCTGG + Intergenic
930035528 2:47083076-47083098 GTGCAGGGCTTGATGAAGGCTGG - Intronic
931267318 2:60672256-60672278 TTGCAGGTGCAGATAAATGCTGG + Intergenic
933250579 2:80024588-80024610 GTGCCGGGGCAGATGAACACTGG + Intronic
933262741 2:80148470-80148492 CTGCAGGGGCAAACTGAGGCAGG + Intronic
933775276 2:85767858-85767880 CTGCAGGGGCACAGGAGGGCAGG + Intronic
933991174 2:87634870-87634892 TGGCTGGGGCAGATGAAGCCAGG + Intergenic
935785035 2:106541093-106541115 GGGCTGGGGCAGAGGAAGGCAGG + Intergenic
936302665 2:111315953-111315975 TGGCTGGGGCAGATGAAGCCAGG - Intergenic
936528973 2:113261938-113261960 CTGCTTGGGAAGCTGAAGGCAGG - Intronic
937911411 2:127077428-127077450 TGGCAGGGGGAGATGAAGGATGG + Intronic
938696760 2:133841756-133841778 CTGCAAGGGGAGAGGAAAGCAGG + Intergenic
940104303 2:150080785-150080807 GGGCAAGGGCAGAGGAAGGCAGG + Intergenic
941670116 2:168284031-168284053 CTGCAGGGGGAGGGGAAGGAGGG - Intergenic
941806545 2:169716394-169716416 CTGCAGCTGCTGATGAAGGGAGG + Intronic
941967877 2:171317761-171317783 CTCCAGGGGCAGCTGAGGGTGGG + Exonic
944427937 2:199603389-199603411 CTGCAGGGGCAGAAGGGAGCTGG + Intergenic
945119107 2:206440580-206440602 CTGCAGTCGTAGGTGAAGGCAGG - Intergenic
945180647 2:207087727-207087749 CTGCAGGCCAAGGTGAAGGCAGG - Intronic
946032725 2:216717822-216717844 CTGCAGGGGCAAGTGCAGTCTGG + Intergenic
946307581 2:218864996-218865018 GGGCAGGGGCAGAAGGAGGCTGG + Intronic
946474890 2:219997506-219997528 GTGGAAGGGGAGATGAAGGCTGG + Intergenic
946716784 2:222561281-222561303 CTGCAGGGGCAGATGAAGGCTGG - Intergenic
947301102 2:228689293-228689315 AGGCAGGAGCAGATGAAGGGAGG - Intergenic
948043114 2:234919984-234920006 CTCCAGGTGCAGACAAAGGCTGG - Intergenic
948879740 2:240850635-240850657 CTGGACGGGGAGATGAAGACAGG + Intergenic
949052158 2:241903162-241903184 CTGCACCGGCAGATGGTGGCAGG + Intergenic
1168793482 20:595899-595921 CTGCAAGGGCAGAGAGAGGCAGG + Intergenic
1168829808 20:839681-839703 CTCCGGGGGCAGATGTAGGGTGG + Intronic
1168903510 20:1386015-1386037 CTACAGTGTGAGATGAAGGCAGG + Intronic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1169742160 20:8906764-8906786 CTGCAAGGGGAGAGGAAGGCAGG + Intronic
1170703267 20:18723248-18723270 CTAGAGGGGCAGGGGAAGGCAGG + Intronic
1170898952 20:20441481-20441503 CAGCAGAGGCAGGTCAAGGCAGG + Intronic
1173869348 20:46331803-46331825 CCGCAGGGGCAGAGGAGGGAGGG + Intergenic
1174809827 20:53636180-53636202 CTTCAGGGGCAGGCTAAGGCAGG + Intergenic
1175161835 20:57013970-57013992 CGGGAGGGGCAGGTGGAGGCGGG - Intergenic
1175756508 20:61533575-61533597 CCTCATGGGCAGAGGAAGGCAGG - Intronic
1175764816 20:61584977-61584999 CTGCAGGGGCGGTGGAAGGAGGG - Intronic
1175851811 20:62097760-62097782 CTGAAGGGGCAGGTGCAGGTGGG + Intergenic
1176117750 20:63440390-63440412 GTGCCGGGGCCGAGGAAGGCAGG + Intronic
1178124254 21:29499976-29499998 CTGCAGGGGCAGCAGAGAGCAGG + Intronic
1178498366 21:33105628-33105650 CTGCTGGGGAAGATGAAGGCTGG - Intergenic
1179071691 21:38077399-38077421 CTGCAGGAGCTGCTCAAGGCAGG + Intronic
1179649039 21:42794721-42794743 CTGCAGGCACAGCTGAAAGCTGG + Intergenic
1181277559 22:21696158-21696180 CTTCAGGGGCTTCTGAAGGCTGG + Intronic
1181343510 22:22200854-22200876 CTGCAGGAGCATATGGAGGGTGG - Intergenic
1181838942 22:25637853-25637875 CTGATGGTGCAGATGAAGTCTGG + Intronic
1181997281 22:26892821-26892843 CCGAAGGGGCAGGGGAAGGCAGG + Intergenic
1182049233 22:27300337-27300359 CTGCAGGGGCAGCAGAAACCAGG + Intergenic
1182359342 22:29737683-29737705 AGGCAGGGGCAGACAAAGGCTGG - Intronic
1182426046 22:30273368-30273390 CCGCCAGGGCAGACGAAGGCAGG + Intergenic
1182660065 22:31918884-31918906 CTGCAGGGGCAGCTGCTGGAAGG - Intergenic
1182934373 22:34207394-34207416 CTGCAAGGGCACCTGGAGGCTGG - Intergenic
1183199032 22:36373251-36373273 GAGCAGGGGCAGCTGAGGGCAGG - Intronic
1183249893 22:36723000-36723022 CTGCAGGGGCAGAGGCATGGAGG - Intergenic
1184271581 22:43387490-43387512 CTGCACTGGCTGATGAAGGGAGG + Intergenic
1184341918 22:43890950-43890972 CTGCAGGGGCGGAAGGAGGGAGG - Intronic
1184355818 22:43978963-43978985 TGGCAGGGGCAGAGGAAGGCAGG - Intronic
1184497495 22:44850505-44850527 CTGCAGGGGCTAATGAAGTTGGG - Intronic
1184502034 22:44880159-44880181 AGCCAGGGGCAGGTGAAGGCCGG + Intergenic
1184715880 22:46281527-46281549 CTGCCGGGGCAGGCGACGGCAGG - Intronic
950520395 3:13494718-13494740 CGGCAAGGGCGGCTGAAGGCGGG - Intronic
953018961 3:39101708-39101730 CCTCATGGGCAGATTAAGGCAGG + Intronic
954318282 3:49813122-49813144 CTGGAGGAGCAGCTGAAGGTGGG - Exonic
954329942 3:49884509-49884531 CTTCCAGGGCTGATGAAGGCTGG - Intergenic
954919227 3:54175318-54175340 CTCAAGAGGCAGATTAAGGCCGG + Intronic
955317597 3:57951799-57951821 CTGGAGGGGCAGAGGCAGCCTGG - Intergenic
955444512 3:58995202-58995224 GTGATGGGGCAGAGGAAGGCAGG - Intronic
955640570 3:61078554-61078576 CTGCATGGGTAGATGAAAGCAGG - Intronic
957805727 3:85146397-85146419 ATGCAGTGGCAAATGAAAGCAGG + Intronic
958911582 3:100000178-100000200 CTGAAGGATCAGAAGAAGGCAGG - Intronic
959162228 3:102736829-102736851 CTGCAGCTGCTGATGAAGGGAGG - Intergenic
961520853 3:127466653-127466675 CTGCAGGGGCAGAGGGGTGCAGG + Intergenic
962937553 3:140094703-140094725 CAGCAGTGGCAGACAAAGGCTGG + Intronic
964452707 3:156826795-156826817 GGTCAGGGGCAGGTGAAGGCGGG - Exonic
964807145 3:160622890-160622912 CTTCAGGGACAGATGAATCCAGG - Intergenic
968662998 4:1806523-1806545 CTGCAGGGGAAGGTGAGGTCAGG - Intronic
968720249 4:2197231-2197253 CTGAAGGGGCAGGTGGAAGCAGG + Intronic
968873850 4:3254991-3255013 CCCCAGGGAGAGATGAAGGCAGG - Intronic
969363524 4:6680679-6680701 CTGCAGAGGTAGCTGAAGGGAGG + Intergenic
969439557 4:7209047-7209069 TTGCAGGGCCACATGAAGCCAGG - Intronic
969523851 4:7694129-7694151 CTGCAGGGGCAGAGGAAGGATGG + Intronic
969608205 4:8212678-8212700 CTGGAGGGGCAGACGGAGGTTGG - Intronic
969869363 4:10095089-10095111 CAGAAGGCGCAGATGAAGACAGG + Intronic
970211922 4:13718559-13718581 ATGTAGGGTCAGGTGAAGGCAGG + Intergenic
972161854 4:36236951-36236973 TTGCAGGGACACTTGAAGGCAGG - Intronic
973565678 4:52184826-52184848 CTGGGGGGGCAGGTGGAGGCAGG - Intergenic
973816391 4:54623266-54623288 CTGCAGGGGGCCAGGAAGGCAGG - Intergenic
975890052 4:79016943-79016965 CTCCAGGGGCAGAGAGAGGCTGG - Intergenic
976744423 4:88389214-88389236 GAGCAGGGGGAGATGAAGTCCGG + Intronic
980100970 4:128540877-128540899 CTGCAAGGGCAGCTGAATGTGGG + Intergenic
980423896 4:132600035-132600057 CTGCTGGGACAGATGGAGGTTGG - Intergenic
982650431 4:158081662-158081684 CTGCAGGAGCAGCTGCAGGCAGG - Intergenic
983703222 4:170624070-170624092 CTGCAGAGGGAGATAAATGCAGG - Intergenic
984846519 4:184112684-184112706 CTTTAGTGGCTGATGAAGGCTGG - Exonic
985337389 4:188911432-188911454 ATGCAGGTGCAGATGGAGGTTGG - Intergenic
985430668 4:189876699-189876721 CTGGAGGGGCGGCTGAAGGGAGG + Intergenic
985608437 5:871979-872001 CTGCAGGGGCAGGTGTGTGCAGG + Intronic
985917084 5:2930340-2930362 GTGCAGGAGCATAAGAAGGCAGG - Intergenic
986308366 5:6532386-6532408 CTGCAGGGGCATATGGTAGCCGG + Intergenic
991001688 5:61789569-61789591 CTGCAGGAGCAGTTGAATTCCGG + Intergenic
992237260 5:74723712-74723734 CTGTAGTACCAGATGAAGGCAGG - Intronic
993840700 5:92875623-92875645 TTGCAGGGGCAGATGTGGGCAGG + Intergenic
995727216 5:115193883-115193905 CTGCTGGGGCAGGTGAAGCTTGG + Intergenic
996116599 5:119627036-119627058 CTTCAGGGGCAGATGTAGAATGG + Intronic
996307192 5:122060796-122060818 CTGCAGGAGCAGATGGAACCAGG - Intronic
996391556 5:122967912-122967934 CTGAAGGGTCAGATTAAGGGAGG - Intronic
996432999 5:123401946-123401968 CTGCAGCAGCAGAAGACGGCCGG - Intronic
996503753 5:124244716-124244738 CTGCAGTGGTGGATGAAGGGAGG - Intergenic
997303759 5:132824299-132824321 CTGCAGGGGCAGATGACTGCTGG - Exonic
997428061 5:133817775-133817797 ATGGAGGGGCAGGTGAAAGCTGG + Intergenic
997459620 5:134043034-134043056 CAGCAGGGGCAGATCCAGGGAGG + Intergenic
997504720 5:134408165-134408187 GGGCAGGGGCAGAGGTAGGCAGG - Intronic
997641165 5:135449757-135449779 CTCCAGGGACAGGTGACGGCGGG + Exonic
998038582 5:138936731-138936753 CACCAGGGGCAGATGGAGGATGG - Intergenic
998103613 5:139454732-139454754 ATGGAGTGGCAGATGCAGGCTGG + Intronic
998696521 5:144646812-144646834 CTGCAGTGGCAGCTGAAGAATGG - Intergenic
998887259 5:146707215-146707237 CTGCAGCAGCAGAAGACGGCTGG - Intronic
999456225 5:151718654-151718676 CTGCAGGGGAACATTAAAGCAGG + Intergenic
1001585846 5:172833638-172833660 CGACAGGGGCAGATGGAAGCAGG + Intergenic
1001995710 5:176156013-176156035 CAGCAGGGACAGAGGAAGGGCGG - Intergenic
1002819048 6:706784-706806 AGGCAGTGGCAGATGAAGGCAGG + Intergenic
1002951425 6:1816104-1816126 CTTCAGGGTCAGATCAAGGCAGG - Intronic
1003167531 6:3694091-3694113 TTTCAGCGGCAGCTGAAGGCTGG - Intergenic
1003287090 6:4744068-4744090 CTGCAGAGGCTGGTGAAGGAGGG + Intronic
1003688039 6:8323784-8323806 CTGCAAGAGTAAATGAAGGCAGG - Intergenic
1004178153 6:13358774-13358796 TTGCCTGGGCAGATGTAGGCAGG - Exonic
1004208599 6:13615274-13615296 CTGCAGGGGGCGATGAAAGTAGG + Intergenic
1004351457 6:14893655-14893677 ATGCAGGTGCAGATAAAGGAAGG - Intergenic
1004725569 6:18308255-18308277 CAGCAGCGGCAGATGCAAGCTGG - Intergenic
1006017284 6:31092051-31092073 CTGCAGGGGAACATGAAGACAGG - Intergenic
1006378967 6:33686982-33687004 GTGGAGGGGCAGAGGGAGGCAGG - Intronic
1006498148 6:34438995-34439017 CTGCTGGGGCAGAGAAAGGGAGG - Intergenic
1007020829 6:38519428-38519450 ATGCAGTGACAGATGAAGACAGG + Intronic
1007109556 6:39304992-39305014 CTGGATGGGCAGATGGATGCTGG + Intronic
1007198301 6:40082622-40082644 AGGCAGGGGCTGATTAAGGCAGG - Intergenic
1007400169 6:41598815-41598837 CAGCAGAGGCAGAGGAAGACAGG + Exonic
1007777032 6:44229657-44229679 CTGCAGGGGCGGCTGACGCCTGG - Exonic
1007819138 6:44547690-44547712 CTGCTGGGGAAGATGAGGGATGG - Intergenic
1007830814 6:44637001-44637023 CTGCAGGCACAGAGGATGGCAGG - Intergenic
1010342808 6:74776238-74776260 CAGTAGGGACAGATGGAGGCAGG - Intergenic
1011449020 6:87473190-87473212 CTGCAGCCGCAGCGGAAGGCAGG - Intronic
1012386219 6:98686225-98686247 CTTCAGGGGCAGAAGAGGTCTGG - Intergenic
1017251562 6:152285570-152285592 CTGGAGTGGCTGAAGAAGGCTGG - Intronic
1017523327 6:155221056-155221078 AAGCAGGGACAGAGGAAGGCAGG - Intronic
1017716349 6:157216487-157216509 CTGGAGGGGGAGATGAGGGTTGG - Intergenic
1017844590 6:158245454-158245476 GTGCTGGTGCAGATGAAGGGAGG + Intronic
1018169235 6:161131315-161131337 CTGCAGGAGCTGAGGAAGGAAGG + Exonic
1018501219 6:164412918-164412940 ATGAAGGGACAGCTGAAGGCTGG + Intergenic
1018688634 6:166324399-166324421 CTGCAGGGTCAGAGGAGGGGAGG - Intronic
1018908399 6:168088257-168088279 CAGCAGGGGCAGGTGACGGCGGG - Intergenic
1019575766 7:1736992-1737014 CTGCAGGGGTAGCTGGGGGCAGG - Intronic
1019595464 7:1856404-1856426 CGGCAGGGGCCGCTGGAGGCAGG - Intronic
1019820309 7:3238033-3238055 CTTCAGGGGCAAATGAAGTGGGG + Intergenic
1021093059 7:16505385-16505407 GTTCTGGGTCAGATGAAGGCGGG - Intronic
1022905137 7:34848479-34848501 CTCCAACAGCAGATGAAGGCTGG - Exonic
1023660735 7:42468711-42468733 CTGCAGGGTGGGAGGAAGGCTGG + Intergenic
1024015684 7:45312141-45312163 CAGCAGTGGCAGATGCAGGCAGG + Intergenic
1024718730 7:52110232-52110254 CTGAAGGGAAAGATGAAGGCAGG + Intergenic
1025202673 7:56971831-56971853 CTGCAGGGGGACATGTTGGCTGG - Intergenic
1025669274 7:63605095-63605117 CTGCAGGGGGACATGTTGGCTGG + Intergenic
1026321127 7:69268436-69268458 CTATAGGGGCAGATGAAGCAAGG - Intergenic
1028805242 7:95018713-95018735 AAGCAAGGTCAGATGAAGGCTGG - Intronic
1029646724 7:101861595-101861617 CTGCAGAGGCACATGTAGGGTGG + Intronic
1030408692 7:109146898-109146920 TTGCTGTGGCAGATGATGGCTGG + Intergenic
1031710211 7:125035325-125035347 CTGAAGGGGCAGGTGCAAGCAGG - Intergenic
1032084597 7:128877312-128877334 CTGCAGGGGGAGTGGGAGGCGGG + Intronic
1032860644 7:135876085-135876107 CTGAGAGGTCAGATGAAGGCAGG - Intergenic
1032932820 7:136694118-136694140 CTGAAGAGGAAGATGAATGCGGG - Intergenic
1033276159 7:139973030-139973052 CTGCGTGGGGAGATGGAGGCAGG + Intronic
1033761655 7:144442391-144442413 CGGCAGGGGCAGATGCTGGTGGG + Intergenic
1035049985 7:155993176-155993198 CAGCAGCGGCTGATGGAGGCAGG - Intergenic
1035049999 7:155993266-155993288 CAGCAGGGGCTGATGGAGGCAGG - Intergenic
1035050016 7:155993356-155993378 CAGAAGGGGCTGATGGAGGCAGG - Intergenic
1035050033 7:155993446-155993468 GAGCAGGGGCTGATGGAGGCAGG - Intergenic
1035050049 7:155993536-155993558 CAGAAGGGGCTGATGGAGGCAGG - Intergenic
1035260198 7:157656292-157656314 TTGCAGGGGCCGAGGAAGGAGGG + Intronic
1035353583 7:158264030-158264052 CTGCACTGGAAGATGAAGGTGGG - Intronic
1036635875 8:10549181-10549203 AGGCGGGGGCAGATGAAGGATGG + Intronic
1037666241 8:20972582-20972604 CTCCAGAGGCAGACAAAGGCTGG + Intergenic
1038038008 8:23702653-23702675 CTGTAGGGGCTGGGGAAGGCAGG + Exonic
1039447180 8:37642198-37642220 AGGCAGGGGCAGGTGAAAGCAGG + Intergenic
1040106625 8:43545591-43545613 TTGCAGGGGGACATAAAGGCAGG - Intergenic
1040111459 8:43568781-43568803 CTTCAGGGGGAGATTGAGGCAGG - Intergenic
1040499537 8:47994860-47994882 CTACAGGGGCAAAGGAAGGAGGG + Intergenic
1041786532 8:61640092-61640114 CTGCAGCGCCAGATCAGGGCAGG + Intronic
1042847319 8:73181399-73181421 CTGCAGGAGCAGATGGTGGTTGG + Intergenic
1044306843 8:90648022-90648044 TTGTAGGGGGAAATGAAGGCAGG + Intronic
1045208274 8:100066861-100066883 ATTCAGGGGCAGATGGAGTCAGG - Intronic
1047006891 8:120630121-120630143 CTGAAGGGGCAAAGGGAGGCTGG - Intronic
1048695447 8:137023001-137023023 CTGCAGGTGCAGATCAAGTAAGG - Intergenic
1048766688 8:137852279-137852301 CTTCAGAGGCAGATGCAGGCTGG - Intergenic
1049151347 8:141037402-141037424 AGGGAGGGGAAGATGAAGGCTGG - Intergenic
1049540946 8:143208537-143208559 CTGCAGGAACAGGAGAAGGCAGG - Intergenic
1049799939 8:144513029-144513051 GTGCAGGTGCAGGTGCAGGCTGG + Exonic
1052367652 9:27631199-27631221 CTGAAGGGGATGATGAAGGAGGG + Intergenic
1053272695 9:36761202-36761224 CTGCAGGGGCAAGTGAAGTGTGG + Intergenic
1053274645 9:36774055-36774077 CTCCAGCAGCAGATGAAGTCTGG - Intergenic
1053576975 9:39363610-39363632 CAGCAAGGGAAGATGCAGGCAGG + Intergenic
1053841482 9:42191535-42191557 CAGCAAGGGAAGATGCAGGCAGG + Intergenic
1054098545 9:60922300-60922322 CAGCAAGGGAAGATGCAGGCAGG + Intergenic
1054119945 9:61197929-61197951 CAGCAAGGGAAGATGCAGGCAGG + Intergenic
1054587811 9:66984633-66984655 CAGCAAGGGAAGATGCAGGCAGG - Intergenic
1054735575 9:68746710-68746732 CTGCAAGGCCAGATGACAGCTGG - Intronic
1054769859 9:69073568-69073590 ATGAAGGGGCAGATAAAGGAAGG + Exonic
1056595515 9:88004923-88004945 CAGGAGGGGGAGATGAAGGGGGG - Intergenic
1057259524 9:93576270-93576292 CTGCCGGGGGAGAAGACGGCCGG - Intergenic
1057744602 9:97741299-97741321 CGGCAGGGGCGGAGGAGGGCGGG - Intergenic
1058436597 9:104969029-104969051 TTGCAGGGGAAGAAGAGGGCAGG - Intergenic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1059358520 9:113720072-113720094 CTCCAGCTGCAGATGGAGGCGGG - Intergenic
1061267203 9:129513859-129513881 CTGCAGGGGGAGGTGCAGCCAGG + Intergenic
1061543047 9:131288625-131288647 CTGCTCGCCCAGATGAAGGCAGG - Intergenic
1061906705 9:133702829-133702851 CTGCAGGGCCAGCCGAGGGCCGG + Intronic
1062212186 9:135371153-135371175 CAGCAGGGGGAGCTGGAGGCAGG - Intergenic
1062235094 9:135504059-135504081 CTGCAGGGCCAGAAGGAGCCCGG + Exonic
1062280157 9:135748269-135748291 CCACTGGGGCAGATCAAGGCAGG + Intronic
1062449428 9:136609321-136609343 CTGGAGGGGCAGCTGCAGGGAGG - Intergenic
1185917990 X:4057376-4057398 CTGCAGGGAAAAATGAAGACAGG - Intergenic
1189526082 X:41823409-41823431 ATGCAGGGGCATGTGGAGGCAGG - Intronic
1192143594 X:68665511-68665533 CTGCAGGTGAAGAAGAACGCTGG + Exonic
1192553062 X:72069288-72069310 CTGCAGAGGCAGATGAAGTGGGG + Intergenic
1193295738 X:79829586-79829608 CTGCAGAGGCAGTTGCAGGGAGG + Intergenic
1193699100 X:84741616-84741638 CTACAGGGGCAAAGGAAGGAGGG - Intergenic
1197798896 X:130328588-130328610 AGGCAGTGGGAGATGAAGGCAGG - Intergenic
1198441917 X:136671774-136671796 CTGCAGGGGCAGCTGCCAGCTGG + Intronic
1199680286 X:150219764-150219786 CTGCGGAGGCAGAGGAAGGCTGG + Intergenic
1199716017 X:150507860-150507882 GGGCAGGGGCAGATGGAGGCTGG - Intronic
1200286840 X:154830862-154830884 CTTCAGCCGCAGCTGAAGGCGGG - Exonic
1201180033 Y:11334092-11334114 CTGCAGGGGCACAGGCGGGCCGG - Intergenic