ID: 946718558

View in Genome Browser
Species Human (GRCh38)
Location 2:222579221-222579243
Sequence CTTTAGGCCTTATGTGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946718558_946718560 -1 Left 946718558 2:222579221-222579243 CCACAGGCACATAAGGCCTAAAG 0: 1
1: 0
2: 0
3: 10
4: 108
Right 946718560 2:222579243-222579265 GCAGAATGTTTTTAAGCTTTTGG 0: 1
1: 0
2: 0
3: 29
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946718558 Original CRISPR CTTTAGGCCTTATGTGCCTG TGG (reversed) Intronic
900515643 1:3080988-3081010 TTTTAGGCCTTTTGTTCATGAGG - Intronic
905549024 1:38821363-38821385 CTTTGGGCCTGATGTCCCTCGGG + Intergenic
908381268 1:63599114-63599136 CTTTAAACCTTATATCCCTGGGG + Intronic
909150366 1:71994827-71994849 CATGAGGCCTTATGTCTCTGGGG - Intronic
909907144 1:81211109-81211131 CTTTAGCCCATTTATGCCTGAGG - Intergenic
910054686 1:83018516-83018538 CCATAGGCCTTCTGTCCCTGTGG - Intergenic
911181597 1:94865512-94865534 CTGTAGGGCTTTTGTGCCTGGGG + Intronic
911453262 1:98092989-98093011 TTTTAGGCATTATGTGAATGAGG - Intergenic
916211532 1:162363897-162363919 CCTTAGGCATTATGCCCCTGTGG + Intronic
918411877 1:184267731-184267753 CTTCAGGCTTTATGTGGCTCTGG - Intergenic
918636064 1:186775713-186775735 CTTTTGGCCATGTTTGCCTGAGG - Intergenic
920566016 1:206974017-206974039 CTGTGGCCCTTATGAGCCTGGGG + Intergenic
920628388 1:207626646-207626668 CTCTAGGCCTGGTGTGACTGTGG - Intronic
924561436 1:245159058-245159080 CTTAACTCCTTCTGTGCCTGAGG - Intronic
1064514841 10:16135827-16135849 TTTTAGTCCTTATGGGCCAGAGG + Intergenic
1068617537 10:59136383-59136405 TGTTAGGCCTGAAGTGCCTGTGG - Intergenic
1069607414 10:69748484-69748506 CTTCGGGCCTCAGGTGCCTGGGG - Intergenic
1070493039 10:76995338-76995360 CCTTAGGCTTTATGGGTCTGGGG - Intronic
1071456985 10:85858438-85858460 CTCTAGGCCTCAAGTGGCTGAGG - Intronic
1072167359 10:92827125-92827147 CTATAGGACTAATGTGCCTATGG + Intergenic
1074689505 10:115991646-115991668 CTTTGGGACTAATGTGCCTGTGG - Intergenic
1078093105 11:8279783-8279805 CTTTATGCCTTCCTTGCCTGAGG + Intergenic
1079589111 11:22160673-22160695 CTTTAGGCCTTATTGGTCAGAGG + Intergenic
1080900862 11:36489604-36489626 TGTTAGGCCTGAAGTGCCTGTGG - Exonic
1081214341 11:40376285-40376307 CTTTAGAAGTTATGTGCTTGAGG - Intronic
1082787259 11:57324096-57324118 CTGGAGGCCTTATCTGCCAGGGG - Intronic
1086599974 11:88621115-88621137 CATTAGCCCTCATGTCCCTGTGG - Intronic
1091255237 11:134178422-134178444 CTTGAGGACTTATCAGCCTGAGG + Intronic
1091719002 12:2798867-2798889 ATTTAGGCCTTGTGTGGCTTTGG + Intronic
1093258653 12:16904960-16904982 CTCTTGGCCTGCTGTGCCTGAGG - Intergenic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1100678186 12:96891133-96891155 CTTTAGGTTTGAGGTGCCTGTGG + Intergenic
1106374797 13:29175692-29175714 CCTTTGGCCTTATGTGGATGTGG + Intronic
1108674358 13:52723433-52723455 CATATGGCCTTATTTGCCTGAGG - Intronic
1109405309 13:61890317-61890339 ATTTAGTCCTTATTTGCCTTGGG - Intergenic
1111862173 13:93721721-93721743 CCTTAGTCCTTATGTGTCTGTGG + Intronic
1112645588 13:101327910-101327932 TTTTAGGCTTTATGGGCCTCAGG + Intronic
1114768616 14:25403463-25403485 CTTTAGGCCACACGTGTCTGTGG + Intergenic
1117202256 14:53403296-53403318 CTCCAGGCTTAATGTGCCTGTGG + Intergenic
1120267810 14:82273953-82273975 GTTTATGCCTTCTGTGTCTGAGG - Intergenic
1120739920 14:88096780-88096802 CTTCAGGCCAGATGGGCCTGCGG - Intergenic
1128926522 15:71661166-71661188 CTTTCTGCCTCATCTGCCTGGGG + Intronic
1129602618 15:77009187-77009209 CCTGAGGCCTTCCGTGCCTGGGG - Intronic
1131891186 15:96973196-96973218 CTTTAGGCATTATATCCATGTGG - Intergenic
1135633232 16:24052465-24052487 CTTTAGGGCTGCTCTGCCTGTGG - Intronic
1135656904 16:24257966-24257988 CTTTGGAGCCTATGTGCCTGAGG + Intronic
1136043074 16:27595677-27595699 CTGTAGAGCTTATGTGCCAGCGG + Intronic
1149349047 17:55768883-55768905 CTAAAGGCTTTATGTGCCTTTGG - Intronic
1149857507 17:60095819-60095841 GCTGGGGCCTTATGTGCCTGAGG + Intergenic
1150114330 17:62532055-62532077 CCTTAGGCCATATGTGGCTTTGG + Intronic
1150550754 17:66207623-66207645 CTTGATACCTTATGTGCCAGTGG - Intergenic
1151236900 17:72727285-72727307 CTTCAGACCGTATGTGCTTGGGG - Intronic
1152209247 17:78994347-78994369 GAGTAGGCCTTAGGTGCCTGAGG - Intronic
1153325065 18:3810254-3810276 CCTTAGGCCTTATATGTCTGAGG + Intronic
1156353785 18:36323454-36323476 CCTGATGCCTGATGTGCCTGGGG - Intronic
1163249455 19:16117840-16117862 CCTAAGGCCCTGTGTGCCTGGGG + Intronic
926330777 2:11823351-11823373 CTTTAAGGCTTATTTGTCTGAGG - Intronic
927885658 2:26717046-26717068 CTTTAGGCTTTATGAGTCTGTGG - Intronic
938066469 2:128284354-128284376 CTTGGGGCCTTGTGTGACTGGGG - Intronic
945458830 2:210080804-210080826 CTTTTTGCCTTATCTGCTTGTGG + Intronic
946718558 2:222579221-222579243 CTTTAGGCCTTATGTGCCTGTGG - Intronic
947704541 2:232263654-232263676 CATTAGGCCTCGTGTACCTGTGG - Intronic
1174616742 20:51841410-51841432 CTTCTTGCCTTTTGTGCCTGAGG - Intergenic
1181831343 22:25563389-25563411 CTTTATGCCTATTGTGCCTTGGG + Intergenic
1183028918 22:35087450-35087472 CTTTAAACCTGAAGTGCCTGAGG - Intergenic
1183705834 22:39474464-39474486 TTTGAGGCCCTGTGTGCCTGTGG + Intronic
1183848813 22:40565745-40565767 CTATAAGCATTATGTGCCTGGGG + Intronic
953070695 3:39516480-39516502 CTTGAGGCATTTTCTGCCTGTGG + Intronic
954630847 3:52047006-52047028 CTTCAGGCCATCTGTGGCTGAGG - Intergenic
957224131 3:77421132-77421154 CTTTAATCCTTCTGTGCCTTAGG + Intronic
962902531 3:139773865-139773887 CTATAGCCCTTACGGGCCTGTGG - Intergenic
964348625 3:155780934-155780956 CTTAAGCCCTTATGTCACTGAGG + Intronic
965564202 3:170094314-170094336 CTTTAAGCCTTGTGTTCCTGGGG - Exonic
969260222 4:6028660-6028682 CTCTGGGCTTTATGTGTCTGAGG - Intronic
970185184 4:13444839-13444861 CTCTAGACCTCATGTGCCTTAGG + Intronic
980279321 4:130699209-130699231 CTTTAGGCCTTATTTGCATAAGG - Intergenic
983638480 4:169922324-169922346 CTTGAGGCCCTAGGAGCCTGTGG + Intergenic
985673713 5:1219499-1219521 CTGCAGGCCTCATCTGCCTGGGG + Exonic
987249451 5:16083311-16083333 CTTTAGGGCTTATGTGGTTTGGG - Intronic
987427825 5:17793715-17793737 CTGTACTCCTTATGTGTCTGTGG + Intergenic
988478429 5:31608798-31608820 ATTTAGTCCATATGTCCCTGAGG - Intergenic
994073420 5:95625701-95625723 ATTTTGGCCTTATGTTACTGAGG - Intergenic
997756596 5:136405520-136405542 CTTTAGGCATTCTTTGCCTCAGG + Intergenic
1000366896 5:160500199-160500221 CTAGAGGCCTCATTTGCCTGGGG + Intergenic
1002673629 5:180890544-180890566 CTCTAGGCCCTGTTTGCCTGGGG - Intergenic
1004875984 6:19955286-19955308 CTTTAACCCTTCTGTGCCTTGGG + Intergenic
1008627015 6:53326701-53326723 CTTGAGGCGTTATGTATCTGTGG + Intronic
1010302965 6:74282904-74282926 TTTTAGAGCTTATGTTCCTGTGG + Intergenic
1013133753 6:107260209-107260231 CTGGAGGACTTATGTGCCTAAGG - Intronic
1014355922 6:120409979-120410001 CTTAAGGCATTCTGTGCCTAAGG + Intergenic
1019794133 7:3037286-3037308 TTTTAGGCCTTGTGAGCCAGAGG - Intronic
1021247457 7:18281060-18281082 CTTTTGGGCAGATGTGCCTGAGG + Intronic
1021297654 7:18928380-18928402 CTTTTGGCTTTATGTGCTTTAGG + Intronic
1021852434 7:24821770-24821792 CGTGAGCCCTTCTGTGCCTGTGG + Intronic
1029024345 7:97400142-97400164 CTTTGGGCCTGATTTTCCTGTGG - Intergenic
1031971866 7:128070450-128070472 CTTTAGGCCTTAGGTGACTTAGG - Intronic
1032044036 7:128587826-128587848 CCTTAGGCCATATGTGGCTTTGG + Intergenic
1032457340 7:132083413-132083435 TCTTGGGCCTTCTGTGCCTGAGG + Intergenic
1034826869 7:154273327-154273349 CTTTAGGGGATGTGTGCCTGTGG - Intronic
1038260834 8:25992556-25992578 CTTTGGGCCTGATGGGTCTGTGG - Intronic
1040552827 8:48451645-48451667 CTCTAGGCCTTGTGTGTGTGTGG + Intergenic
1042499315 8:69491522-69491544 CTTTAGGGCTTAAGTTCATGAGG - Intronic
1042912050 8:73837871-73837893 CTTTAGGCCTTTTCGCCCTGGGG - Intronic
1052603803 9:30672319-30672341 CTTGCGGCCTTGTGTCCCTGGGG + Intergenic
1055101606 9:72471317-72471339 ATTTAGCCATGATGTGCCTGGGG - Intergenic
1057973744 9:99581803-99581825 CTTGAGGCCTATTGTGCCTTGGG + Intergenic
1058257325 9:102783860-102783882 CTTTGGGCTTTGTGTGTCTGTGG - Intergenic
1186627443 X:11309511-11309533 CTTTCAGCCTTCTGTGCCTGGGG - Intronic
1188495552 X:30779761-30779783 CAATACGCCTTATGTGGCTGAGG + Intergenic
1188595898 X:31900073-31900095 CATTATGACTTATGTGCCTTTGG + Intronic
1189138859 X:38579801-38579823 CATTATGCCTTATTTGCCTCAGG + Intronic
1190432621 X:50392576-50392598 CCTTAGCCCTTATCTGTCTGTGG + Intronic
1191640951 X:63429387-63429409 CCTTGGCCCTTATGTGCCTCAGG - Intergenic
1192332451 X:70187331-70187353 CTTCAGGGCTTCTCTGCCTGCGG - Intronic
1197794545 X:130285332-130285354 CTTTTGTGCTGATGTGCCTGGGG - Intergenic
1198450139 X:136758965-136758987 TTTTAGGGCTAATGTACCTGTGG - Intronic
1199089456 X:143674210-143674232 GTTTAAGCTTTATGTGCCTCAGG - Intergenic
1199890241 X:152071793-152071815 CTAGAGGCCTTATTTGCTTGAGG + Intergenic
1200933434 Y:8717508-8717530 CTGTAGGTTTTATGTGGCTGTGG - Intergenic