ID: 946718565

View in Genome Browser
Species Human (GRCh38)
Location 2:222579369-222579391
Sequence ACCTTAGGACATACCCAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946718565 Original CRISPR ACCTTAGGACATACCCAAGT AGG Intronic
906371769 1:45259820-45259842 AACTGAGGACAAACCCAATTAGG + Intronic
913279515 1:117172513-117172535 ACCCTAGGCCACACACAAGTCGG - Intronic
919346645 1:196389170-196389192 ACCTTGGGATAAACCCAACTAGG + Intronic
1063499135 10:6537369-6537391 ATCTTGTGACATATCCAAGTCGG + Intronic
1064642213 10:17426460-17426482 AGCTTCAGAGATACCCAAGTGGG + Intronic
1068724579 10:60287120-60287142 AGCCTAGGACATGCCCAAGGTGG - Intronic
1080880414 11:36314531-36314553 CCCTTAAAACATAGCCAAGTGGG - Intronic
1085089164 11:73695156-73695178 AACTCAGGACATCCCAAAGTGGG + Intronic
1089682609 11:120127629-120127651 ACCTAAAGACATACCCGACTAGG - Intronic
1090071997 11:123551807-123551829 GCCTTAGGATATTCCCCAGTAGG + Intronic
1106125656 13:26898208-26898230 CCCTGAGGACATGCCCATGTGGG - Intergenic
1106582684 13:31031577-31031599 AGCTGAGGACATCCCCAGGTAGG - Intergenic
1111104525 13:83628558-83628580 ACTGTAGGACATACCCATTTTGG + Intergenic
1112072765 13:95873428-95873450 GCATTAGAACATACCCAAATGGG + Intronic
1114247405 14:20927604-20927626 ACCTTAGGATCTGCCCACGTTGG - Intergenic
1119343874 14:73905144-73905166 TCCTTAGGAAAGACTCAAGTGGG + Intronic
1121366072 14:93311774-93311796 TCTTTAGGATATACCCAACTTGG + Intronic
1122909361 14:104819554-104819576 ACATTCGGAAATACCCAAGGTGG - Intergenic
1138348950 16:56336256-56336278 GGCTTAGGACATGCCCAAGCTGG - Intronic
1141262899 16:82469887-82469909 TCCTGAGGACATGCCCAAGGTGG - Intergenic
1146020452 17:29273653-29273675 CTCTTAAGATATACCCAAGTAGG + Intronic
1158951372 18:62498468-62498490 ACCTAAGGAAATACCTAAGATGG + Intergenic
1165053177 19:33156198-33156220 ACCTGAAGACATACCTAAGTGGG - Intronic
930058528 2:47270397-47270419 ACCATAGGACAAAGCCCAGTAGG + Intergenic
938610516 2:132943150-132943172 TCCTCTGGACATACCCAAATGGG + Intronic
939066776 2:137492886-137492908 ACCTCAGGTAATACCCATGTCGG - Intronic
941875991 2:170433904-170433926 ACATTAGGTCATGTCCAAGTGGG + Intronic
945697840 2:213130497-213130519 ACCTTAAGACCCACCCAAGCAGG + Intronic
946718565 2:222579369-222579391 ACCTTAGGACATACCCAAGTAGG + Intronic
951298051 3:20963503-20963525 AACTCAGGACATACCCATCTAGG + Intergenic
953152174 3:40334544-40334566 ATCTAAGGCCAAACCCAAGTGGG + Intergenic
955020127 3:55112110-55112132 TCCCTAGAACAAACCCAAGTTGG - Intergenic
955538323 3:59948269-59948291 ACCTTATGATCTACCCACGTTGG - Intronic
959185190 3:103037941-103037963 ACATTAGGTCATACCAAAGTGGG + Intergenic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
964666282 3:159177524-159177546 ACCTCAGGAAATACCTGAGTGGG - Intronic
965230137 3:166040056-166040078 ACCCTGGGACATACCCTACTAGG - Intergenic
972094656 4:35334053-35334075 CCATTAGGAAATACCCCAGTGGG + Intergenic
977270469 4:94911835-94911857 ACCTTAGCAAATACACAAATTGG - Intronic
982461567 4:155675954-155675976 GCCTTAGGACAGGACCAAGTGGG - Intronic
983994036 4:174159482-174159504 ACATTGGGACATACACCAGTGGG + Intergenic
984096773 4:175444604-175444626 ATATTAGGACACTCCCAAGTCGG + Intergenic
999027161 5:148246702-148246724 ACCCTAGGATAAACCCCAGTTGG + Intergenic
1001676932 5:173526476-173526498 ACCTTATGAAATACCCAAGCCGG + Intergenic
1004114803 6:12756364-12756386 ACTTTAGCACCTACCAAAGTGGG - Intronic
1005613735 6:27552745-27552767 GCCTTAAGATTTACCCAAGTTGG - Intergenic
1007037438 6:38689234-38689256 ACAGTGGGACAGACCCAAGTCGG + Intronic
1013945220 6:115715073-115715095 ACCTTTGAACAGAACCAAGTAGG + Intergenic
1014722702 6:124937462-124937484 AACTTAGGAATTAACCAAGTTGG + Intergenic
1015358827 6:132312702-132312724 CCCTCAGGAAATACTCAAGTTGG - Intronic
1018260460 6:161965604-161965626 TCCTGAGAACATACCCAAGGTGG + Intronic
1027243617 7:76350402-76350424 ACGTTAAGACAGACCCAAGAGGG - Intronic
1039435878 8:37558943-37558965 ACCTTTGGAGACACCCCAGTAGG - Intergenic
1040109263 8:43559297-43559319 ACCTTAGGAGAGATCCAAGTGGG - Intergenic
1042483930 8:69331393-69331415 ACGTTTGCACAAACCCAAGTGGG + Intergenic
1048233684 8:132669033-132669055 ACCTTCTGACTTGCCCAAGTTGG - Intronic
1051156781 9:14156785-14156807 ACCCTAGGACAGAAGCAAGTAGG - Intronic
1051557144 9:18396897-18396919 ACCTTAGTACATTCCTAAATAGG + Intergenic
1194953666 X:100154853-100154875 ACCCTAGGATAAACCCAACTTGG + Intergenic