ID: 946721055

View in Genome Browser
Species Human (GRCh38)
Location 2:222608282-222608304
Sequence CTGGAGCCCTCAAATAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946721055 Original CRISPR CTGGAGCCCTCAAATAATGG AGG (reversed) Intronic
900550551 1:3252366-3252388 CTGAATCCCTCAAATAGAGGGGG + Intronic
903025295 1:20425570-20425592 CTGGAACCCTCATATATTGCTGG + Intergenic
903548119 1:24139779-24139801 CTGAACCCCTCAAACAATGCTGG - Intronic
905182327 1:36175096-36175118 CTGGAGCCCTCACATACTCCAGG + Intronic
906689975 1:47786040-47786062 CAGGGACCCTGAAATAATGGTGG + Intronic
906701796 1:47864997-47865019 CTGCAGCTCTCAGATCATGGGGG + Intronic
908602111 1:65751672-65751694 ATGGAGCAATCAAATAATAGGGG + Intergenic
908853625 1:68398055-68398077 CTGGAGCCTGGATATAATGGTGG + Intergenic
911956030 1:104236305-104236327 ATGGAGCCCTAAAATCATAGAGG - Intergenic
916198257 1:162245405-162245427 CTGGAACTCTCACATAATGCTGG + Intronic
916222461 1:162458536-162458558 CTGGAGCACTCATATACTGCTGG + Intergenic
921507341 1:215988620-215988642 CTGGAACCCTTAAATACTGTTGG - Intronic
922123954 1:222704200-222704222 CTGGAACCCTCAGATATTGCTGG + Intronic
922208196 1:223467223-223467245 CTGGAGCCCACTGATCATGGGGG - Intergenic
922742822 1:228024282-228024304 CTGGAACCCTCAAACAATACTGG - Intronic
924012492 1:239680957-239680979 GGGGAGGCCTCAAATCATGGCGG + Intronic
924029183 1:239869296-239869318 CTTGAGCCCTAAAATGATGAAGG + Intronic
1062816783 10:506732-506754 CTGGAGCCCCCAAAGCACGGAGG + Intronic
1063084944 10:2808329-2808351 CTGGAGCCCTCATACATTGTTGG + Intergenic
1064782078 10:18852956-18852978 GTGGAGCCCTCACATACTGCTGG + Intergenic
1065626704 10:27637036-27637058 CTAGAGCTCTCAAATACTGCTGG - Intergenic
1069007301 10:63332444-63332466 CTGGATCCTTATAATAATGGAGG + Intronic
1069742598 10:70694987-70695009 CTGGAACCCTCATACATTGGTGG - Intronic
1072519412 10:96217425-96217447 CTGGAGCCCTCATACATTGCTGG - Intronic
1074598514 10:114889602-114889624 ATGGAGCCCTGAAGTAATAGAGG - Intronic
1074956704 10:118397731-118397753 CAGGTGCCCTCCAAGAATGGTGG + Intergenic
1075708850 10:124519713-124519735 TTGGAGACCTCAAGGAATGGAGG - Intronic
1076187368 10:128460096-128460118 CTGGAGCCCTCAGCTGCTGGAGG - Intergenic
1076739777 10:132477488-132477510 CTGGAGCCCCCAACCAATGGGGG - Intergenic
1078772273 11:14361619-14361641 CTGGAGCCCTCATACACTGCTGG + Intronic
1081667900 11:44927200-44927222 CTGGGGCCCTCAGATAAAGGAGG - Intronic
1081976386 11:47238008-47238030 CTTGGGTCCTCAAATAATGATGG + Intronic
1087575978 11:99990178-99990200 AAGGAGCCCTCAAATGATGGTGG + Intronic
1088874883 11:113926870-113926892 TTGGAGCCCTCAAACATTGCTGG - Intronic
1091944360 12:4522541-4522563 CTGGAACCCTCATACATTGGTGG + Intronic
1092016276 12:5161408-5161430 AGGGAGCCTTCAAATCATGGTGG + Intergenic
1092080298 12:5710482-5710504 GGGGAGACCTCAAAGAATGGAGG + Intronic
1093791403 12:23254666-23254688 CTGAAGCCCTCAGGTAAGGGAGG + Intergenic
1096024984 12:48352503-48352525 CTGTGGCCCTCAGATAAGGGAGG + Intergenic
1098063594 12:66588367-66588389 CTAGAGCCCTCAATTAGAGGGGG - Intronic
1104728930 12:131094503-131094525 CTGGACCCCTCTAATCCTGGAGG + Intronic
1105626405 13:22117263-22117285 CTGGAGCCCTCCAAGCCTGGTGG - Intergenic
1107140008 13:36988144-36988166 CTGCTGCCCTCAAAAGATGGTGG + Intronic
1107543545 13:41415959-41415981 GGGGAGGCCTCAAATCATGGTGG + Intergenic
1107872576 13:44760712-44760734 CAGGAAACATCAAATAATGGAGG + Intergenic
1108719503 13:53116906-53116928 GGGGAGGCCTCAAATTATGGTGG + Intergenic
1108967381 13:56326620-56326642 CAGGAGTCCGAAAATAATGGAGG + Intergenic
1109083706 13:57942145-57942167 TTGCAGCCCACAAATAATTGGGG - Intergenic
1109276993 13:60314259-60314281 CAGGAGCCCTCCAATATTTGGGG + Intergenic
1110166832 13:72452464-72452486 CTGGAGCCCTCAAAGACATGGGG - Intergenic
1110566494 13:76962370-76962392 CTGGAACCCTCATATATTGTTGG - Intergenic
1112625205 13:101096101-101096123 CTGGAACCCTTACATACTGGTGG + Intronic
1115129054 14:30031651-30031673 CTGGAGCCCTGAAATGCTTGGGG + Intronic
1116571328 14:46519811-46519833 CTGGATCCCTAAATGAATGGAGG - Intergenic
1117420132 14:55536415-55536437 CTGGACCTCTCAAATACTGCTGG + Intergenic
1118493072 14:66280481-66280503 CAGGGGCACTCAAATAATGCTGG + Intergenic
1120035099 14:79687584-79687606 CTTGAGCCCTGAAATAAAGGAGG - Intronic
1120348284 14:83318701-83318723 CTGTAGCCCTAAATTAATGCTGG - Intergenic
1121055407 14:90847530-90847552 CTGGAACCCTCGAAGGATGGGGG + Intergenic
1121760290 14:96439264-96439286 TTGGAACCCTCCAATATTGGAGG + Intronic
1122660435 14:103291200-103291222 CTGAAGCTCTCAAGCAATGGAGG + Intergenic
1122660503 14:103291736-103291758 CTGGGGCTCTCAATCAATGGAGG + Intergenic
1122660507 14:103291765-103291787 CTGAAGCTCTCAATCAATGGGGG + Intergenic
1122660561 14:103292183-103292205 CTGGGGCTCTCAATCAATGGAGG + Intergenic
1123702219 15:22923492-22923514 CTGGAGCCCTCACTTACTGCTGG + Intronic
1123918173 15:25052406-25052428 GTGGAGCCGCCCAATAATGGCGG - Intergenic
1125571550 15:40723226-40723248 CTGGAACCCTCATATACTGCTGG + Intronic
1126791585 15:52226501-52226523 CTGGAGCCCTTAAATACTCAGGG - Intronic
1128380890 15:67111613-67111635 CTGGAACCCTCATACATTGGTGG - Intronic
1128471955 15:67961904-67961926 CTGGAGCCCCCAGATAATCCTGG + Intergenic
1128878533 15:71222270-71222292 CTGAAGTCCTCAAATAAGAGAGG - Intronic
1130618972 15:85441144-85441166 CTGAAGCCCTCATATATTGCTGG - Intronic
1132058901 15:98674456-98674478 CTGTAGACCTCATATAAAGGAGG - Intronic
1133857255 16:9561099-9561121 CTGGAGCACTCCAATATCGGAGG + Intergenic
1140109225 16:71988667-71988689 CTGGAGCCCTAAGAGAATGGAGG - Intronic
1141950958 16:87339039-87339061 GGGGAGGCCTCAAATCATGGTGG - Intronic
1143221929 17:5269354-5269376 TTGGAGCCCTCAAACATTGCTGG + Intergenic
1143396591 17:6604015-6604037 CTGGATCCCTCAAACACTGCTGG + Intronic
1144815895 17:18034606-18034628 CTGGACCCCTCAAACACTGCTGG + Intronic
1145407604 17:22619031-22619053 CTGTAGCTCTCAAATACTGATGG + Intergenic
1146577635 17:34008727-34008749 CTGGAACTCTCAAAGAGTGGAGG - Intronic
1151869150 17:76824787-76824809 CTGGAGCCCCCAGATGCTGGAGG - Intergenic
1152463246 17:80452114-80452136 CTGGAGCCCACAGATGGTGGAGG - Intergenic
1157891494 18:51422396-51422418 CTGGAGTCCTCTAATCCTGGTGG + Intergenic
1159593996 18:70365152-70365174 CTGGATACCTCAAACATTGGTGG - Intergenic
1162258494 19:9512938-9512960 CTGGGCCCCTCAAACAATGAGGG - Intergenic
1163161492 19:15467343-15467365 CTGGAGCTCACAGATGATGGAGG + Intergenic
1163394059 19:17048772-17048794 CTGGAGCCCTTTAATATTGAGGG - Intergenic
1167019167 19:46861296-46861318 CCGGAGCCCGCGAACAATGGAGG + Intergenic
1168649746 19:58085583-58085605 CTGGAGGCCTCCAACAACGGAGG + Intronic
1168679974 19:58307765-58307787 CTGGGCCCCTCAAACAATGAGGG + Intronic
927507181 2:23622163-23622185 CTGGGGCACTCAAGTAATGAAGG + Intronic
927609169 2:24520127-24520149 CTGGAACGCTCACATTATGGTGG + Intronic
929192245 2:39150268-39150290 CTGCTGCCGTCAGATAATGGTGG - Intergenic
929583552 2:43099892-43099914 CTGGAACCCTCATATATTGCTGG + Intergenic
931514191 2:63033099-63033121 CTGGAGTCCTGCAATAATGTTGG + Intronic
934953691 2:98598509-98598531 CTGGAACCCTCAAAGATTGTTGG + Intergenic
936118057 2:109718098-109718120 CTGGAACCCTCACATATTGCTGG + Intergenic
937800495 2:126076047-126076069 TGGGAGGCCTCAAATCATGGTGG - Intergenic
938777157 2:134551960-134551982 CCTGAGCCCTCAAATGAGGGTGG - Intronic
940466413 2:154034000-154034022 CTGGAGCCCTCAGACATTGCTGG + Intronic
941283554 2:163581713-163581735 CTGGTTCCCTTAAATACTGGGGG - Intergenic
942393058 2:175516500-175516522 CTGTAGCCCTCCATTACTGGAGG + Intergenic
943884834 2:193203217-193203239 CTGGAGTCTCCAAATAATTGTGG + Intergenic
946721055 2:222608282-222608304 CTGGAGCCCTCAAATAATGGAGG - Intronic
948092957 2:235310961-235310983 TTGGAGCCCTCATATATTGCTGG + Intergenic
948133050 2:235614979-235615001 GTGGTGCGCTCAAATAAAGGAGG + Intronic
1168905338 20:1398911-1398933 CTGGGTCCCTCAAACAATGAGGG + Intergenic
1179578239 21:42321091-42321113 CTGGAGCCCTCAGAGAGAGGAGG + Intergenic
1182239230 22:28901589-28901611 ATGGAGTCCTCAAATTTTGGGGG + Intronic
1183143413 22:35966449-35966471 CTGGAACCCTCATGTACTGGTGG - Intronic
1183652241 22:39163583-39163605 CTGGAACTCTCAAATAGTGTTGG - Intergenic
1183790349 22:40062594-40062616 CTGGAACCCTCATATACTGCTGG - Intronic
1184083595 22:42243940-42243962 CTGGAACCCTCACATATTGCTGG + Intronic
949194956 3:1293986-1294008 CTGGAACTCTCAAATATTGCTGG + Intronic
950303262 3:11899803-11899825 CTGGAGCCCTCACCTTGTGGAGG + Intergenic
950399163 3:12757618-12757640 CTGGAGCCCTCATACATTGCTGG + Intronic
950506796 3:13400052-13400074 CTGGAGCCCTCAGCTTGTGGAGG - Intronic
950574171 3:13821300-13821322 CTGGAGCCCTCAGACACTGCTGG + Intronic
952884559 3:38004283-38004305 CTGGAGCACTCAAACAGTCGTGG - Exonic
954740939 3:52749974-52749996 CTGGAACCCTCATATATTGCTGG + Intronic
956758479 3:72414319-72414341 CTGGAACCCTCATATGTTGGTGG + Intronic
956862724 3:73340359-73340381 CTGGAGCCCCCAAAAGCTGGAGG - Intergenic
956966665 3:74469725-74469747 ATGGAACCCTCAAATACTGCTGG + Intronic
957398959 3:79684063-79684085 CTGGAGTCCTCATATATTGCTGG - Intronic
957688154 3:83530992-83531014 CAGGAGCCCTCATATACTGCTGG + Intergenic
959967566 3:112374101-112374123 CTGGAGCCATCAAAAGCTGGAGG + Intergenic
960187162 3:114657776-114657798 CCGGTGCCTTCAAATAATTGTGG + Intronic
961106577 3:124248037-124248059 CTGGAAAACTCATATAATGGGGG + Intronic
961387689 3:126531921-126531943 TTGGAGCCCTCATATATTGCTGG - Intronic
961833745 3:129639612-129639634 CTGGAACCCTCATATACTGCTGG + Intergenic
962549598 3:136476169-136476191 CTGGAAGCCTCAAATAAGGCAGG + Intronic
963209549 3:142673870-142673892 CTGGAGCCCTCATACATTGCTGG - Intronic
967062814 3:185887171-185887193 CTGGAACCCTCACGTACTGGTGG - Intergenic
968009695 3:195265933-195265955 ATGAAACCCCCAAATAATGGTGG - Intronic
968656046 4:1778875-1778897 CTGGACCCCTCAAATACGGTAGG - Intergenic
968936126 4:3611492-3611514 CTGGAGCCCCCACACAATGAGGG + Intergenic
970629968 4:17930131-17930153 CTGGAACCCTCATACAATGTTGG + Intronic
971911181 4:32799233-32799255 TTGGAGCACTCAAACCATGGGGG - Intergenic
972463752 4:39331914-39331936 CTGGATCCCTCCCATAATGTGGG - Intronic
973170005 4:47130299-47130321 CTGGAGCCCAGACATTATGGGGG - Intronic
979829217 4:125280007-125280029 CTGGAGATCACAAATGATGGTGG + Intergenic
980064370 4:128168220-128168242 CTGGAACCCTCATATATTGTTGG - Intronic
980689362 4:136274373-136274395 CTGGTGCCCACACATAATGGTGG - Intergenic
980862430 4:138515640-138515662 CTGGAACCCTCATACAATGCTGG - Intergenic
981890973 4:149736715-149736737 CTGGAACCCTCAAGTATTGCTGG + Intergenic
984221067 4:176976403-176976425 CTGGAGCTCTCACATACTGCTGG + Intergenic
984441877 4:179781091-179781113 CTGGAGCCCACTGATAATGGGGG - Intergenic
984589358 4:181600297-181600319 CTGGAGCCCTCAGATTTTAGAGG - Intergenic
985753429 5:1697478-1697500 CTTGAGATCACAAATAATGGTGG - Intergenic
987500029 5:18697845-18697867 GGGGAGGCCTCAAATCATGGTGG + Intergenic
991246230 5:64511144-64511166 CTGAAACCCTCAAGGAATGGTGG + Intronic
992055400 5:72984000-72984022 CTGGAACTCTCAAATAAGGATGG - Intronic
992208685 5:74456043-74456065 ATGGAGCCCTGACAGAATGGGGG - Intergenic
992600746 5:78396688-78396710 CTGGTGCACTCGAATATTGGAGG + Intronic
993211238 5:84954486-84954508 CTGGATCCCTCATATAATGCTGG + Intergenic
995021222 5:107369406-107369428 CAGGATGCCTCAAATAATGAGGG + Intergenic
995788097 5:115853088-115853110 CTGGAGCCCTCAGACATTGTTGG - Intronic
997199763 5:132002765-132002787 CAGGAGCCCTCACACAGTGGCGG + Intronic
998218984 5:140260255-140260277 CTGGAACCCTCATATATTGCTGG + Intronic
998387885 5:141768526-141768548 CTTGAGCACTCAAAAAGTGGGGG + Intergenic
1000052108 5:157572339-157572361 CTGCAGAACTCAAATACTGGCGG + Intronic
1000341777 5:160282842-160282864 CTGGAACCCTCATATACTGCTGG + Intronic
1003151673 6:3557502-3557524 CTGGAACCCTCACATATTGTGGG + Intergenic
1004085985 6:12449720-12449742 CTGGAGCCATCAGATACCGGAGG + Intergenic
1004268549 6:14172658-14172680 CTGGAACCCTCAAACATTGTTGG + Intergenic
1006097459 6:31665085-31665107 CCCGAGCCCTCAAGTAATGTGGG - Intronic
1007726680 6:43921044-43921066 GTGAAGCCTTCAATTAATGGTGG + Intergenic
1010935005 6:81850458-81850480 CTGCAGCCATAAAATAATGGTGG - Intergenic
1011482810 6:87811977-87811999 ATGGAGACCTCAGATAAGGGAGG + Intergenic
1013122481 6:107152954-107152976 CTATAGGCCTCAAATTATGGTGG + Exonic
1016442495 6:144098159-144098181 CTTGAGACTGCAAATAATGGTGG - Intergenic
1018623805 6:165757953-165757975 CTGGAGACCTCAAATAAGCTTGG - Intronic
1020113717 7:5463177-5463199 TTGGAACCCTCAAATATTGCTGG + Intronic
1020586221 7:10072281-10072303 CTGGAGCTCTCAAATAGTTCTGG + Intergenic
1021418857 7:20422133-20422155 CTGGACCCCTCAAGCCATGGAGG + Intergenic
1021776101 7:24056954-24056976 CTGGAGCCCTCTCATCCTGGAGG - Intergenic
1022553939 7:31272589-31272611 CTGGAGCCCTGAAATTCTGCTGG - Intergenic
1024397022 7:48881540-48881562 ATGAAGCCTTCAAATACTGGAGG + Intergenic
1026429455 7:70329392-70329414 CTGGAACCCTCATATATTGCTGG - Intronic
1027237312 7:76305683-76305705 CTGGGTCCCTCAAATATTTGAGG - Intergenic
1029166110 7:98592236-98592258 CTGGAGTCCTCAAACCAAGGGGG - Intergenic
1033612482 7:142978014-142978036 CTGGATCACTCATATATTGGTGG + Intergenic
1034586415 7:152097379-152097401 CTGGAGCCCTCACATGTTGCTGG + Intronic
1034677191 7:152900439-152900461 CTGGAGTCCTTATAAAATGGGGG - Intergenic
1036821873 8:11947143-11947165 CAGCAGCCCTCAACTAATGAGGG + Intergenic
1037543171 8:19891369-19891391 TTGGAGCCTTCAGAAAATGGTGG + Intergenic
1038357700 8:26845459-26845481 CTAGAGCCCTCAAACATTGCTGG + Intronic
1039735603 8:40329195-40329217 CTGTCGCCCTCATATAATGTTGG + Intergenic
1046461288 8:114540345-114540367 CTGGATCCCTCATATATTGCTGG + Intergenic
1047909849 8:129516101-129516123 CTATAGCACTCAAATAGTGGTGG + Intergenic
1050425831 9:5511752-5511774 GGGGAGACCTCAAATAATGAAGG - Intronic
1051371046 9:16359385-16359407 AGGGAGGCCTCAAATCATGGTGG - Intergenic
1051700754 9:19820787-19820809 CTGGACCCTTCAAATCATGCTGG + Intergenic
1051745545 9:20291684-20291706 CTGGAGCACTAAAATAATTTGGG + Intergenic
1052674737 9:31605851-31605873 CTGGAGCTCTCAAAGACTGCTGG - Intergenic
1053154400 9:35765762-35765784 CTGGAACTCTCATATAATGCTGG - Intergenic
1054708506 9:68486888-68486910 CTGGAACCCTCATATACTGTTGG - Intronic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1055568787 9:77595418-77595440 CAGCAGCCCTCAATAAATGGTGG - Intronic
1055805787 9:80091627-80091649 CTGGAGCCCTCATACACTGCTGG + Intergenic
1062519246 9:136950831-136950853 CTGGAGCCCTGAAGTCCTGGGGG + Intronic
1187491521 X:19756352-19756374 CTGGTCCTCTCAAAGAATGGGGG + Intronic
1188685004 X:33058708-33058730 CTGGAGCTCTCAAATATTGCTGG - Intronic
1190534839 X:51416115-51416137 CAGGAACCCTCACATAGTGGTGG - Intergenic
1193097014 X:77561646-77561668 CTGGAAGCCTCATATAATGCTGG - Intronic
1194052375 X:89087188-89087210 GTGGAGCCCTCATATATTGCTGG + Intergenic
1194083067 X:89491504-89491526 CTGGAGCTCTCACATATTGTTGG + Intergenic
1200435720 Y:3147378-3147400 CTGGAGCTCTCACATATTGTTGG + Intergenic
1200703521 Y:6422197-6422219 CTGCAGCCCTCTGATAACGGTGG + Intergenic
1201030590 Y:9742510-9742532 CTGCAGCCCTCTGATAACGGTGG - Intergenic