ID: 946725286

View in Genome Browser
Species Human (GRCh38)
Location 2:222655967-222655989
Sequence CTGCCTCCGAGAAGAGGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946725275_946725286 26 Left 946725275 2:222655918-222655940 CCTTCAGGAAGGCATGAATGTCG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 946725286 2:222655967-222655989 CTGCCTCCGAGAAGAGGCGTAGG 0: 1
1: 0
2: 0
3: 3
4: 88
946725281_946725286 -5 Left 946725281 2:222655949-222655971 CCCTTTTGGAGGGAGGCCCTGCC 0: 1
1: 0
2: 2
3: 24
4: 186
Right 946725286 2:222655967-222655989 CTGCCTCCGAGAAGAGGCGTAGG 0: 1
1: 0
2: 0
3: 3
4: 88
946725279_946725286 3 Left 946725279 2:222655941-222655963 CCACATTGCCCTTTTGGAGGGAG 0: 1
1: 0
2: 0
3: 11
4: 138
Right 946725286 2:222655967-222655989 CTGCCTCCGAGAAGAGGCGTAGG 0: 1
1: 0
2: 0
3: 3
4: 88
946725282_946725286 -6 Left 946725282 2:222655950-222655972 CCTTTTGGAGGGAGGCCCTGCCT 0: 1
1: 0
2: 1
3: 36
4: 208
Right 946725286 2:222655967-222655989 CTGCCTCCGAGAAGAGGCGTAGG 0: 1
1: 0
2: 0
3: 3
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946725286 Original CRISPR CTGCCTCCGAGAAGAGGCGT AGG Intronic
900692184 1:3987556-3987578 CTGCCTCCCAGTAGAGGAGGTGG + Intergenic
900864726 1:5260230-5260252 CTGCCACAGAGAAGAGGGGCAGG - Intergenic
901771454 1:11532289-11532311 CTGCCTCCGTGCAGAGACCTGGG + Intronic
902180310 1:14683309-14683331 CTGTCTCAAAGAAGATGCGTAGG + Intronic
902609206 1:17587482-17587504 CTGCCTCAGAGGAGGGGCCTGGG - Exonic
903786048 1:25862086-25862108 CTGCCTCTGAGCAGAGGCCCAGG + Exonic
906479877 1:46193022-46193044 CTGCCTGCAAGAAGAGGGTTGGG - Intronic
915230424 1:154441768-154441790 CTGCCTCCCAGACTAGGTGTGGG + Intronic
915616772 1:157045549-157045571 CTGCCTGCGAGATTAGGCGAGGG - Intergenic
919795825 1:201320901-201320923 CTGCCTCCCAGAAAAGCCATTGG + Intronic
921172980 1:212565601-212565623 GTGCCACCCAGAAGAGGGGTGGG + Intronic
922209246 1:223474911-223474933 CTGCCTCCCAGCAGAAGCCTGGG + Intergenic
1066104666 10:32146022-32146044 CTGCCTCCCACAACAGGCTTTGG - Intergenic
1067279526 10:44860865-44860887 CTGCCTCCTAGAGTTGGCGTGGG + Intergenic
1070745357 10:78930499-78930521 CTGACTCAGAGCAGAGGCGGTGG - Intergenic
1071346633 10:84699919-84699941 CTGCCTCCCAACAGAGGAGTTGG - Intergenic
1071568764 10:86685108-86685130 CTCCCTCCCAGAAGAGACGCAGG - Intronic
1071793852 10:88985027-88985049 CTGCCACCTATAAAAGGCGTTGG + Intronic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1072420981 10:95290633-95290655 CAGCCTCCGCGAAGGGGCGGCGG + Intronic
1073169524 10:101491843-101491865 CTGTCTCGGAGAAAAGGCTTGGG + Intronic
1073331812 10:102674856-102674878 CTGCCTGCTAGGAGAGGCCTTGG + Exonic
1075892968 10:125970294-125970316 CTGCCTCCCAGACGGGGCGGCGG + Intronic
1085347462 11:75777385-75777407 CTGCCTAGGAACAGAGGCGTAGG - Intronic
1086207928 11:84282629-84282651 CTGTCTCCTTGAAGAGGGGTTGG + Intronic
1087111969 11:94480206-94480228 TTGCCTCTGAGAAGAGGAGCTGG - Intronic
1092022514 12:5214347-5214369 CTGGCTGAGAGAAGAGGCCTTGG + Intergenic
1096427983 12:51520543-51520565 CTGCCTCCCAGAAGATAAGTTGG - Intergenic
1102526996 12:113519618-113519640 CTCCCTCCGAGCAGGGGCGGTGG + Intergenic
1105419555 13:20240245-20240267 CTTCCTCCCAGCAGAGGCTTCGG + Intergenic
1113797476 13:113066791-113066813 CTGCCTCCGAGCTGAGGAGCAGG + Intronic
1118265958 14:64294995-64295017 CTTCGCCCGAGAAGAGGGGTGGG - Intronic
1120940098 14:89939614-89939636 CTGCCCCCTAGAGGAGGTGTGGG - Intronic
1125721802 15:41848726-41848748 CAGCCTCCTAGAATAAGCGTGGG + Intronic
1127300534 15:57648880-57648902 CTGCCTCTGAGAAGAAGAGAGGG - Intronic
1129728532 15:77916372-77916394 CTGCCTCCCAGAAGAGGTGAGGG + Intergenic
1145093887 17:20008782-20008804 CTGCATCCCGGAGGAGGCGTTGG + Intergenic
1146498653 17:33345438-33345460 CAGCCTCCAAGAAGAGGCATAGG - Intronic
1163591184 19:18194939-18194961 CTGCCTGCGGGGAGAGGCGGGGG - Exonic
1166745783 19:45141260-45141282 CTGCCCTGGAGGAGAGGCGTGGG - Intronic
927503287 2:23596370-23596392 CTGTCTCCGAGCAGAGGTCTTGG + Intronic
928183837 2:29091485-29091507 ATGCCTCCCAGAAGAAGTGTGGG - Intergenic
930081374 2:47451689-47451711 CTTCCTGCTAGAAGAGGGGTGGG + Intronic
930358200 2:50346802-50346824 CGGCCTCCTAGGAGTGGCGTGGG - Intronic
934717326 2:96551497-96551519 CAGCCTCAGAGAGGAGGCGCAGG + Exonic
936944176 2:117915660-117915682 TTGCCTCTGGGAAGAGGGGTGGG - Exonic
937964585 2:127493156-127493178 CAGCCTGCCAGAAGAGGGGTTGG - Intronic
941877303 2:170447117-170447139 CTGCTTCAGAGAAGAGCTGTGGG + Intronic
946725286 2:222655967-222655989 CTGCCTCCGAGAAGAGGCGTAGG + Intronic
948336415 2:237210932-237210954 CTGCATCCAAGAAGAGGAGCAGG + Intergenic
1171447883 20:25217584-25217606 CTGCTTTCGGGAACAGGCGTGGG + Intronic
1181538867 22:23562415-23562437 CTTCCTCCGAGAAGTGGGGGTGG + Intergenic
1183357440 22:37367223-37367245 CTGGCCCCGAGCAGAGGCTTGGG + Intergenic
1184479850 22:44739892-44739914 GTGACTCAGGGAAGAGGCGTGGG + Intronic
949386001 3:3502941-3502963 CTGAATCTGAGAAGAGGCTTTGG + Intergenic
949573432 3:5315287-5315309 GAGCCTCCCAGAAGAGGAGTTGG - Intergenic
953793401 3:45965433-45965455 CTGCCTCAGAGAGGAGGGTTAGG + Intronic
958641728 3:96814370-96814392 CTGCAGCTGTGAAGAGGCGTGGG - Intergenic
961033435 3:123625921-123625943 CTGCCTCTGATAAAAGGCATGGG - Intronic
964407661 3:156366412-156366434 CTGGCTCCTAGAAGAGGACTGGG + Intronic
968425767 4:522276-522298 CAGCCTCCCAGCAGAGGTGTGGG + Intronic
971231235 4:24801273-24801295 CTGCCTCCGAGTACAGCCTTAGG + Intergenic
978382466 4:108144044-108144066 CTGCCTCAGAGGTGAGGAGTGGG + Intronic
978586292 4:110279217-110279239 CTGTCCCCGAGAAGAGGGGAAGG - Intergenic
980837917 4:138219874-138219896 CTACCTCCTAGAAGAGAAGTTGG + Intronic
984296941 4:177864148-177864170 CTGACTTAGAGAAGAGGCCTTGG - Intronic
991930403 5:71748448-71748470 ATGTCTCCGAGGAGAGGCGGTGG + Intergenic
992890008 5:81195251-81195273 CTGCCTCCGAGAAGGCGCTCGGG + Intronic
994995947 5:107063296-107063318 CTGCTTCAGGGAAGAGGGGTGGG + Intergenic
996401655 5:123069409-123069431 CTCCCTCCTATAAGGGGCGTTGG - Intergenic
997235366 5:132269322-132269344 CAGCCTCCGGGCAGAGGCTTTGG - Intronic
998355847 5:141535832-141535854 CTGCCTCTGAGCAGAGGAATGGG + Intronic
999031410 5:148297091-148297113 CTGTCTCAGAGAAGAGACATGGG + Intergenic
1002896664 6:1383678-1383700 CCGCCTCCGAGAAGCTGCTTTGG - Intergenic
1002960195 6:1906944-1906966 CAGCCTCCGAGAGGAGGCAAGGG + Intronic
1003015928 6:2467412-2467434 CTTCCTCCTTGAAGAGGTGTTGG - Intergenic
1007171278 6:39865215-39865237 CAGCCTCCCAGGAGAGGAGTAGG - Intronic
1007294838 6:40813930-40813952 CTGCCTCTGAGAAAAGGGGATGG + Intergenic
1011351961 6:86433375-86433397 CTGCCTCCCAGAAAAGGGGCAGG + Intergenic
1012611023 6:101220662-101220684 CTGCATCTGAGAAGTGGAGTTGG - Intergenic
1019634351 7:2067536-2067558 CTGCCGCCGAGGAGAGGCCCGGG - Intronic
1032513626 7:132491376-132491398 CTCCCTCCCAGAAGAGGTGCGGG + Intronic
1039536910 8:38324768-38324790 CATCCTCCGAGAAGGGGAGTGGG + Intronic
1046740091 8:117818591-117818613 CTGTCTCTGAGAAGAGGCTTTGG - Intronic
1046848918 8:118951667-118951689 CTCCCTCCCAGGAGAGGCTTGGG - Intronic
1057134932 9:92680764-92680786 CAGCCTCCGTGAAGATGCCTGGG + Intergenic
1060849101 9:126860427-126860449 CCGACTCCGGGAAGCGGCGTCGG - Intergenic
1061114930 9:128604087-128604109 CTGCCTCAGAGAGGATGCCTAGG + Intronic
1188968850 X:36588066-36588088 CTGCCTCTGTGAAGATGCTTAGG + Intergenic
1192962490 X:76145327-76145349 CCGCCTCCCCGAAGAGGCGGTGG + Intergenic
1192963043 X:76149760-76149782 CCGCCTCCCCGAAGAGGCGGTGG - Intergenic
1198530267 X:137545540-137545562 CTGCTTCCGCGAAGAGACGGTGG + Intergenic