ID: 946727408

View in Genome Browser
Species Human (GRCh38)
Location 2:222674081-222674103
Sequence GTGAGTTACTCAAGATCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 1, 2: 16, 3: 87, 4: 455}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946727404_946727408 12 Left 946727404 2:222674046-222674068 CCCTCATTTTACCAATGAAGGAA 0: 1
1: 2
2: 20
3: 219
4: 1030
Right 946727408 2:222674081-222674103 GTGAGTTACTCAAGATCACATGG 0: 1
1: 1
2: 16
3: 87
4: 455
946727407_946727408 1 Left 946727407 2:222674057-222674079 CCAATGAAGGAACTAGGAGATAA 0: 1
1: 0
2: 0
3: 16
4: 197
Right 946727408 2:222674081-222674103 GTGAGTTACTCAAGATCACATGG 0: 1
1: 1
2: 16
3: 87
4: 455
946727401_946727408 19 Left 946727401 2:222674039-222674061 CCCGTTACCCTCATTTTACCAAT 0: 1
1: 0
2: 3
3: 24
4: 340
Right 946727408 2:222674081-222674103 GTGAGTTACTCAAGATCACATGG 0: 1
1: 1
2: 16
3: 87
4: 455
946727402_946727408 18 Left 946727402 2:222674040-222674062 CCGTTACCCTCATTTTACCAATG 0: 1
1: 0
2: 7
3: 61
4: 460
Right 946727408 2:222674081-222674103 GTGAGTTACTCAAGATCACATGG 0: 1
1: 1
2: 16
3: 87
4: 455
946727405_946727408 11 Left 946727405 2:222674047-222674069 CCTCATTTTACCAATGAAGGAAC 0: 1
1: 8
2: 90
3: 703
4: 3359
Right 946727408 2:222674081-222674103 GTGAGTTACTCAAGATCACATGG 0: 1
1: 1
2: 16
3: 87
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946727408 Original CRISPR GTGAGTTACTCAAGATCACA TGG Intronic
900822896 1:4903006-4903028 GTGAGTTTCACAAGATCTGATGG - Intergenic
900885899 1:5415212-5415234 GTGACTTGCTCAAGGTCACAGGG - Intergenic
901437118 1:9254015-9254037 GTCAGTTGCTGGAGATCACAGGG + Intronic
901931698 1:12600068-12600090 GTAACTTGCTCAAGGTCACACGG + Intronic
902177511 1:14661984-14662006 AAGTGTTTCTCAAGATCACACGG - Intronic
902217464 1:14943664-14943686 GTGACCTGCTCAAGATCACTTGG + Intronic
902376380 1:16031956-16031978 GTGACTTGCTCAAGGTCACACGG - Intronic
902381347 1:16053885-16053907 GTGACTTGCCCAAGGTCACACGG - Intronic
902525313 1:17053661-17053683 TTGAATTGCTCAAGGTCACATGG - Intronic
903250777 1:22052017-22052039 GTGACTTGCCCCAGATCACAGGG - Intergenic
903334823 1:22617821-22617843 GTGACTTGCCCAAGGTCACACGG + Intergenic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903703896 1:25270717-25270739 GTGACTTGCTCAAGGTCACAGGG - Intronic
903723345 1:25422607-25422629 GTGACTTGCTCAAGGTCACAGGG + Intronic
903976816 1:27155442-27155464 GTAACTTGCTCAAGGTCACACGG - Intronic
904583985 1:31569003-31569025 GTGACTTGCTCAAGGTCACATGG + Intergenic
904752477 1:32749532-32749554 GTGACTTGCTCAAGTTCACATGG + Intronic
905002858 1:34686744-34686766 GTGACATACTCAAGGTCACATGG - Intergenic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
907490245 1:54804864-54804886 GTGACTTGCTCAAGATCCCACGG + Intergenic
907557795 1:55359805-55359827 GTGAATTGCACAAGGTCACATGG + Intergenic
908255318 1:62298607-62298629 GTGACTTACCCAAGGTCACACGG - Intronic
909428158 1:75552139-75552161 GTGGCTTGCCCAAGATCACAGGG - Intronic
910141618 1:84032598-84032620 GTAAGTTTCACAAGATCTCATGG - Intergenic
913044073 1:115058466-115058488 GTAACTTGCTCAAGGTCACAAGG + Intronic
913186736 1:116375214-116375236 GTGACTTGCTCAAGGTCAAACGG + Intronic
915525030 1:156470670-156470692 GTAACTTACCCAAGGTCACATGG - Intronic
915538351 1:156551437-156551459 GGGATTTGCTCAAGGTCACATGG + Intronic
915567349 1:156722943-156722965 GTTAATTACTCAAGACCAAAAGG + Exonic
915725214 1:158012366-158012388 GTGACTTGCACAAGGTCACACGG - Intronic
915960207 1:160260250-160260272 GTAACTTGCTCAAGGTCACATGG + Intronic
916334471 1:163654757-163654779 GTTAGTAACTCAAGATCACTTGG + Intergenic
916610967 1:166391115-166391137 CTGACTTTTTCAAGATCACATGG - Intergenic
918084848 1:181236900-181236922 GTGATTTGTGCAAGATCACATGG - Intergenic
918105874 1:181414750-181414772 GTGACTTTCTCAAGGTCACGTGG + Intronic
919083967 1:192898951-192898973 GTGAGTTGCTTATGATCACAAGG + Intergenic
919588155 1:199464921-199464943 GTGAGTTTCACAAGATCTGATGG - Intergenic
920872920 1:209808927-209808949 GTGATTTACTCAAGGTCACATGG + Intergenic
921467025 1:215501148-215501170 GTGCTTTACTCAAGATCACAGGG + Intergenic
921532107 1:216297122-216297144 GGCAATTACTCAAGAACACAGGG - Intronic
921964604 1:221075166-221075188 GTAACTTTCTCAAGGTCACAAGG - Intergenic
922729910 1:227944461-227944483 ATGAGGTACTCAAAATCACGGGG + Intronic
922945117 1:229507764-229507786 GTGACTTACACCAGATCACACGG + Intronic
923641560 1:235766605-235766627 GTAACTTACCTAAGATCACATGG - Intronic
1063454312 10:6172554-6172576 GTGACTTATCCAAGACCACAGGG + Intronic
1064382264 10:14856363-14856385 GTAGCTTCCTCAAGATCACACGG + Intronic
1064686896 10:17871771-17871793 GTACGTTATTCAACATCACAAGG + Intronic
1064836124 10:19533144-19533166 GTGAGTAGCTAAAGAACACAGGG - Intronic
1065837549 10:29672769-29672791 GTGAGTAGCTCAAGAGAACATGG - Intronic
1065850445 10:29783333-29783355 GCGATTTGCTCAAGGTCACATGG + Intergenic
1065924128 10:30420941-30420963 GTGACTTGCCCAAGGTCACATGG + Intergenic
1065966808 10:30777349-30777371 GTGACTTGCTCAAGTCCACAGGG + Intergenic
1066414589 10:35209034-35209056 ATAAGTTGGTCAAGATCACATGG + Intronic
1066456001 10:35572787-35572809 GTGAGTCGCTCAAGAACACAGGG - Intergenic
1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG + Intergenic
1067472273 10:46545885-46545907 GTAACTTGCCCAAGATCACATGG + Intergenic
1067915144 10:50389502-50389524 GTGTTTTACTTAAGATCACAAGG + Intronic
1067966088 10:50914381-50914403 ATGAGATACTCAAGGTAACATGG - Intergenic
1068614122 10:59093215-59093237 GTGATTTACTCAGTGTCACATGG - Intergenic
1068767214 10:60777123-60777145 GTGATATACTCTATATCACAAGG + Intergenic
1069861855 10:71476412-71476434 GTGACATGCTCAAGGTCACATGG + Intronic
1070692872 10:78540779-78540801 GTAACTTGCCCAAGATCACAAGG + Intergenic
1070743200 10:78916155-78916177 GTGAGTTACCCAAGGTCACAGGG + Intergenic
1070772852 10:79092380-79092402 GTGACTGACCCAAGATCACATGG - Intronic
1070802117 10:79249935-79249957 GTGACTTACTCAAAGTCACCTGG - Intronic
1072159301 10:92751524-92751546 GAGACTTACTTAAGGTCACATGG + Intergenic
1072237061 10:93462484-93462506 GTAACTTGCTCAAGATCACAGGG + Intronic
1072569775 10:96648433-96648455 GTGACTTACCCAACGTCACAAGG + Intronic
1073044923 10:100631470-100631492 GTGACTTACCAAAGGTCACATGG + Intergenic
1073064715 10:100751184-100751206 GTGATTGTCTCAAGATCCCAAGG - Intronic
1073581338 10:104668388-104668410 GTGAATTAATTAAGACCACAGGG + Intronic
1073590904 10:104756763-104756785 GAGAGGTACTAAAGCTCACAAGG - Intronic
1074299812 10:112223543-112223565 GTGATTTGCTTAAGGTCACAAGG - Intergenic
1074921315 10:118016773-118016795 GTAACTTGCTCAAGGTCACAGGG - Intronic
1074993260 10:118731302-118731324 GTGACTTCCTCAAGAACTCAAGG + Intronic
1075756824 10:124818840-124818862 GTGACTTCCTCCAAATCACAGGG - Intronic
1076201771 10:128564621-128564643 TTGAGTTAGCCAAGATCACACGG - Intergenic
1078561104 11:12373517-12373539 GAGATTTACCCAAGATCACCTGG + Intergenic
1078868101 11:15317191-15317213 GTAACTTGCCCAAGATCACACGG - Intergenic
1078910930 11:15731105-15731127 GTGACTTGCTCAGGTTCACATGG + Intergenic
1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG + Intergenic
1079587238 11:22141036-22141058 GTGACTTTCCCAAGGTCACATGG - Intergenic
1079937955 11:26641316-26641338 GTGACTTGCTAAAAATCACACGG + Intronic
1080048871 11:27838101-27838123 CTGAGTTACTCCAGCTCTCATGG - Intergenic
1080067729 11:28039072-28039094 GTGAGTTGCCCAAGGTCACTTGG - Intronic
1082626661 11:55495403-55495425 GTGAGTTCCACAAGATCTGATGG - Intergenic
1082813489 11:57493192-57493214 ATGACTTGCTCAAGCTCACAGGG + Intronic
1083258794 11:61512017-61512039 GTGACTTGCTCAAGATCACTTGG - Intergenic
1083403384 11:62440197-62440219 GTGGCTTTCTCAAGCTCACAGGG + Intronic
1084284515 11:68122271-68122293 GTGCGTTAGTCACGGTCACAAGG - Intergenic
1085170763 11:74448119-74448141 GTGGGTTGCCCAAGGTCACATGG - Intergenic
1085394151 11:76198174-76198196 GTGACTTGCTCAAGGTCGCAAGG - Intronic
1085781438 11:79412516-79412538 GTGACTTATCCAAGGTCACATGG - Intronic
1085803781 11:79615869-79615891 GTAACTTACCCAAGAACACATGG - Intergenic
1085821577 11:79799217-79799239 GTAACTTAGTCAAGATCACATGG + Intergenic
1085986186 11:81791574-81791596 GTGAGTCTCACAAGATCTCATGG - Intergenic
1086367648 11:86123991-86124013 GATAGTGGCTCAAGATCACAGGG - Intergenic
1086668639 11:89518764-89518786 GTGAATTACTCCACGTCACATGG - Intergenic
1087140346 11:94759649-94759671 GTGAATTACCTGAGATCACATGG - Intronic
1088247891 11:107837140-107837162 GTGACTTAGTGAAGAACACAGGG + Intronic
1089159287 11:116425063-116425085 GTGAATTGCCCAAGGTCACAGGG + Intergenic
1089938738 11:122393673-122393695 GTGAGTTGCTCAACAGCCCAAGG - Intergenic
1090405605 11:126474374-126474396 GTGACTGGCTCAAGGTCACATGG + Intronic
1090499678 11:127249158-127249180 GTGATTTGCACAAGCTCACATGG - Intergenic
1091481320 12:834616-834638 GTGAATTGCTCAAGATCGTATGG - Intronic
1091503862 12:1046779-1046801 GTAAGTTGCCCAAGGTCACATGG + Intronic
1091536236 12:1412669-1412691 GTGACTTTCCCAAGGTCACAGGG - Intronic
1091600906 12:1917155-1917177 GTGACTTCCCCAAGTTCACAAGG - Intronic
1091641824 12:2242951-2242973 GTGACTTACCCACGATCATAGGG + Intronic
1093535435 12:20217677-20217699 GTGGGTTAGTGAAGATAACAGGG + Intergenic
1094299647 12:28948424-28948446 GTGATTTGCCCAAGGTCACATGG + Intergenic
1095354368 12:41254358-41254380 GTAAGATACTCAAAGTCACATGG + Intronic
1095569359 12:43665770-43665792 CTGAGTATCTCAAAATCACATGG + Intergenic
1095712595 12:45306530-45306552 GTCAGTTACACAAAATCTCAGGG - Intronic
1098004168 12:65977574-65977596 GTTAGTTGTTCAAGAGCACACGG - Intergenic
1098860588 12:75705689-75705711 GTGATTTACCCAAGGTCATATGG - Intergenic
1099155214 12:79166855-79166877 ATGATTTACTCAAAATAACATGG - Intronic
1099979878 12:89586200-89586222 GTAACTTACTCTAGGTCACATGG - Intergenic
1100007873 12:89916024-89916046 TTGAGTTACTAAAGATTTCATGG - Intergenic
1100647083 12:96542979-96543001 GCAAGTTAATCAACATCACATGG - Intronic
1100707975 12:97222141-97222163 GTGACTTGCCCAAGGTCACACGG + Intergenic
1101210461 12:102530412-102530434 GTGACTTGCCTAAGATCACAAGG + Intergenic
1101241894 12:102847209-102847231 GTGACTTGCTCATGATCACAGGG + Intronic
1102126429 12:110485283-110485305 GTGAGATACTGCAGATGACAAGG + Intronic
1102161557 12:110773326-110773348 GTCATTTGCTCAAGGTCACATGG + Intergenic
1102193435 12:111006766-111006788 GTGATTTGCCCAAGATCACATGG - Intergenic
1102212920 12:111139922-111139944 GTGACTTACCCAAGGTCACACGG - Intronic
1102302616 12:111781719-111781741 GTGACTTACCCAAGGTCACTTGG + Intronic
1102511619 12:113419424-113419446 GTGACTTACAAAAGGTCACAGGG + Intronic
1102638401 12:114344791-114344813 GTGACTTGCTCAAGGTCATAGGG - Intergenic
1102639925 12:114358062-114358084 GTGACTTGCCCAAGGTCACATGG + Intronic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1102846456 12:116189889-116189911 GTGAGTTCAGCAAGGTCACAGGG - Intronic
1102972114 12:117177150-117177172 GGGATTTACTCAAGGTCACAGGG + Intronic
1103158923 12:118711234-118711256 GTGAGTTGCCCAATACCACATGG - Intergenic
1103174410 12:118849758-118849780 GTGACTTGCACAAGGTCACACGG + Intergenic
1103333395 12:120170710-120170732 GTGTGTTGCTCAAGGTCACACGG + Intronic
1104180070 12:126370971-126370993 GTGAGTTACCCTGGGTCACAGGG + Intergenic
1104234713 12:126922698-126922720 GTAACTTACTCAAGATCACAAGG + Intergenic
1104707588 12:130958940-130958962 GCGATTTGCTCAAGGTCACAGGG + Intronic
1106997813 13:35508104-35508126 GTAATTTGCTTAAGATCACAGGG + Intronic
1107631975 13:42351567-42351589 CAGATTTACCCAAGATCACAAGG + Intergenic
1108005371 13:45941047-45941069 GTGATTTGCTCAAGGTCAAACGG - Intergenic
1109318067 13:60775774-60775796 GTGAGTCTCTCAAGATCTGATGG - Intergenic
1109830425 13:67779646-67779668 GTGAGTTACTCTACATCATCTGG + Intergenic
1112038388 13:95519016-95519038 GCAATTTACTCAAGGTCACATGG - Intronic
1112106411 13:96245317-96245339 GTGAGTTACAGAAGAGTACAAGG + Intronic
1112468078 13:99662247-99662269 TCAAGTTACTCAAAATCACACGG - Intronic
1112686192 13:101830587-101830609 GTGACTTACTTAGGATCAAAGGG - Intronic
1112868932 13:103944420-103944442 GAGAGTTACTCACTATCATAAGG - Intergenic
1113236413 13:108279998-108280020 GGGTATTACTCAACATCACACGG - Intronic
1113469053 13:110531483-110531505 GTGACTTGCCCAAGGTCACACGG - Intronic
1114813869 14:25932515-25932537 GTGACTTGCCCAAGGTCACAGGG + Intergenic
1115199972 14:30842800-30842822 ATTACTTGCTCAAGATCACATGG + Intergenic
1115581768 14:34766806-34766828 GAGAGTTAATCAAAACCACAAGG + Intronic
1115667425 14:35567524-35567546 GTGACTTGGCCAAGATCACAAGG + Intronic
1115756476 14:36531340-36531362 GTAAATTGCTGAAGATCACATGG + Intergenic
1116799000 14:49423205-49423227 ATAACTTACTCAAGGTCACATGG - Intergenic
1117012846 14:51488443-51488465 GGGATTTATTCAAGGTCACATGG + Intergenic
1117387049 14:55225962-55225984 GTTACACACTCAAGATCACATGG - Intergenic
1117457597 14:55913473-55913495 GTGACTTGCCCAAGATCTCACGG + Intergenic
1117545550 14:56792108-56792130 GTGAGGAAATCAAGATCAGATGG - Intergenic
1118595184 14:67429957-67429979 GTAACTTCCTCAAGATCACGTGG + Intergenic
1118649692 14:67877329-67877351 GTGATTTGCCCAAGATCATATGG + Intronic
1119158584 14:72433771-72433793 GTGACTTGCCCAAGGTCACATGG - Intronic
1119931884 14:78555596-78555618 ATGATTTGTTCAAGATCACAAGG - Intronic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1120232944 14:81859394-81859416 GTGAGTTGCCCAAGGTCAAATGG - Intergenic
1120737302 14:88067087-88067109 GTGACTTGCTCAAGATTACTAGG - Intergenic
1120798226 14:88659860-88659882 AGCAGTTACTCAAGATCACCAGG + Intronic
1120833271 14:89016898-89016920 GTGACTTGCTCAAGGTCACATGG - Intergenic
1121033148 14:90676392-90676414 GTGACTGGCCCAAGATCACATGG + Intronic
1121285473 14:92732101-92732123 GTGACTTGCTCAAGGTCACATGG - Intronic
1121535376 14:94687111-94687133 GTGACTTCCTCAAGGTCACACGG + Intergenic
1121691139 14:95877598-95877620 ATGACTTAATCAAGGTCACAAGG + Intergenic
1122005974 14:98703949-98703971 GTGAGTTACCCAAGAGGGCAAGG + Intergenic
1122016413 14:98800575-98800597 GTGACTTGTTCAAGATCTCAAGG - Intergenic
1122024849 14:98868192-98868214 GTGACTTTCTCAAGATCATGTGG - Intergenic
1123506922 15:20951645-20951667 GTGATTGACTCAACATCACACGG - Intergenic
1123564151 15:21525397-21525419 GTGATTGACTCAACATCACACGG - Intergenic
1123600405 15:21962681-21962703 GTGATTGACTCAACATCACACGG - Intergenic
1125173485 15:36793422-36793444 GTGACTTGCTTAAGATAACACGG - Intronic
1126582718 15:50255959-50255981 GGGACTAACTCAAGTTCACATGG + Intronic
1126737831 15:51750154-51750176 GTGACTTATTCAAGGTCATAGGG - Intronic
1127689271 15:61378456-61378478 GTGATTTGCTCAAGCTCATATGG + Intergenic
1127785681 15:62352823-62352845 GTAATTTGCCCAAGATCACATGG - Intergenic
1127964125 15:63911342-63911364 GTAATTTCCTCAAGGTCACACGG + Intronic
1128099169 15:64984160-64984182 ATGACTTACCCAAGATCACATGG + Intronic
1128469876 15:67943319-67943341 GTGAGTTATTCAACCTCACTGGG - Intergenic
1129508255 15:76101149-76101171 GTGACTTTCCCAGGATCACATGG + Intronic
1129682669 15:77666639-77666661 GTTAGCTGCTCCAGATCACAAGG - Intronic
1129788932 15:78327833-78327855 GTGACTTACCCAAGGTCCCATGG - Intergenic
1130872324 15:87981225-87981247 GTGTCTTACCCAAGGTCACATGG - Intronic
1202972510 15_KI270727v1_random:252493-252515 GTGATTGACTCAACATCACACGG - Intergenic
1133654265 16:7844617-7844639 GTGACTTGCTCAATGTCACACGG + Intergenic
1134174333 16:11993626-11993648 GTAACTTGCTCATGATCACATGG + Intronic
1134372991 16:13643024-13643046 GTGAACTGCTCAAGGTCACATGG - Intergenic
1134541404 16:15069634-15069656 GTCATTTTCCCAAGATCACATGG - Intronic
1134663318 16:16000493-16000515 GTGACTTGCCCAAGTTCACATGG + Intronic
1134681281 16:16127568-16127590 GTTACTTGCCCAAGATCACATGG + Intronic
1134752802 16:16639509-16639531 ATAAGTTGCTCTAGATCACATGG + Intergenic
1134993256 16:18719567-18719589 ATAAGTTGCTCTAGATCACATGG - Intergenic
1135001907 16:18783830-18783852 GTGACTTGCCCAAGATCTCATGG + Intronic
1135359392 16:21799214-21799236 GTCATTTTCCCAAGATCACATGG - Intergenic
1135436859 16:22434191-22434213 GTCATTTTCCCAAGATCACATGG - Intronic
1135924312 16:26679096-26679118 ATGACTTGCTCAAGGTCACAAGG - Intergenic
1135968640 16:27055964-27055986 GTCACTTGCCCAAGATCACATGG + Intergenic
1136263401 16:29097730-29097752 GTCATTTTCCCAAGATCACATGG + Intergenic
1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG + Intergenic
1137466466 16:48714307-48714329 GTAATTTATTCAAGAACACAGGG + Intergenic
1137576135 16:49601558-49601580 GTGACTTGTTCAAGGTCACAAGG + Intronic
1137790637 16:51171870-51171892 GGGACTTGCTCAGGATCACATGG - Intergenic
1137829729 16:51532984-51533006 GTGACTTGCCTAAGATCACAGGG + Intergenic
1138480267 16:57298126-57298148 GTGATCTACCCAAGGTCACACGG + Intergenic
1139098167 16:63731251-63731273 GTGTGTTATCTAAGATCACATGG + Intergenic
1140028411 16:71312920-71312942 GTGATTCACCCAAGGTCACAGGG + Intergenic
1140439440 16:74975730-74975752 GTAACTTGCCCAAGATCACATGG + Intronic
1140722919 16:77787658-77787680 ATGAGTTGCCCAAGATCTCAAGG + Intergenic
1140822422 16:78675216-78675238 GTGACTCACTCAAGATCACGTGG + Intronic
1140995292 16:80253053-80253075 GAGACTTGCCCAAGATCACACGG - Intergenic
1141470223 16:84233234-84233256 GTGACTTTCCCAAGATCACTGGG + Intronic
1141545617 16:84766250-84766272 GTGACTTGTTCAAGGTCACATGG - Intronic
1141884294 16:86881138-86881160 GTGAATTCCTGAAGGTCACACGG + Intergenic
1143982120 17:10879192-10879214 GTGACTTCCTCAAGGTCGCATGG - Intergenic
1144475117 17:15580982-15581004 ATAATTTGCTCAAGATCACACGG + Intronic
1145755396 17:27386341-27386363 GCGAGTCACCCAAGATCACCTGG - Intergenic
1145803448 17:27707435-27707457 GTGAAATACTCAAGAGCACAAGG - Intergenic
1146008476 17:29177059-29177081 GGGACTTGCTCAAGGTCACACGG - Intronic
1146309088 17:31753248-31753270 GTAACTTATTCAAGTTCACATGG - Intergenic
1146413535 17:32610534-32610556 ATGAGTCACTCAAGATCACATGG - Intronic
1146667246 17:34713307-34713329 GTGACATGCTCAAGAGCACATGG - Intergenic
1146994090 17:37302788-37302810 ATGAGTTTATCAAGATCACAGGG - Intronic
1148546456 17:48522788-48522810 GTGACTTACCCAAGGACACAAGG + Intergenic
1149035490 17:52129489-52129511 GTAACTTGCTTAAGATCACATGG + Intronic
1149445028 17:56706682-56706704 ATTACTTGCTCAAGATCACACGG + Intergenic
1150142872 17:62744704-62744726 GTGATTTTCCCAAGCTCACATGG - Intronic
1150937123 17:69648757-69648779 GTTTCTTACTCAAGATCATATGG + Intergenic
1151539235 17:74756700-74756722 GTCAGTTGCTCAAGTACACATGG - Intronic
1152997993 18:426055-426077 GTGACTTGTCCAAGATCACATGG + Intronic
1155319147 18:24601793-24601815 GTGACTCACTCAGGATCACGTGG + Intergenic
1156458734 18:37309284-37309306 GTGACTTCCTCAACAACACATGG - Intronic
1157100320 18:44723461-44723483 GTGATTTGTTCAAGATCACATGG + Intronic
1158308597 18:56134187-56134209 GTGGCTTGCTCAAAATCACATGG + Intergenic
1158890987 18:61871495-61871517 GTAATTTACTTAGGATCACAGGG + Intronic
1160233222 18:77064991-77065013 GTGACTTGCCCAAGACCACAGGG - Intronic
1161867481 19:6844129-6844151 GTGAATTACTTAATGTCACATGG + Intronic
1162556208 19:11387560-11387582 GTAACTTACTCAAGGTCCCATGG - Intronic
1163174622 19:15555803-15555825 GTGACTTACCCAAGATCATTCGG + Intergenic
1164573005 19:29387612-29387634 GTGACATGCTCAGGATCACATGG - Intergenic
1164952355 19:32347325-32347347 GTGACTTACCCAAGGTTACATGG - Intronic
1165155214 19:33782761-33782783 GTGAGTTCCACAAGATCTGATGG - Intergenic
1166351562 19:42201167-42201189 GTGACTTGCCCAAGGTCACACGG + Intronic
1166656262 19:44614215-44614237 GTCACCTACCCAAGATCACAGGG + Intronic
1166773491 19:45298407-45298429 GTGACTTGCTCAAGGTCACTTGG - Intronic
925575515 2:5356024-5356046 GTGAGTGAGGCTAGATCACATGG + Intergenic
926931603 2:18046728-18046750 GTGATTCACTCAAGGTCACTTGG + Intronic
927070893 2:19528570-19528592 TTTACTTGCTCAAGATCACAGGG + Intergenic
927742473 2:25584010-25584032 GTGATTTTCTCCAGATCACGTGG - Intronic
927749264 2:25651980-25652002 TTGAGTTGGTCAAGGTCACATGG + Intronic
927760658 2:25750617-25750639 GTCATTTACTTAATATCACACGG - Intronic
928083678 2:28332373-28332395 GTGGCTTGCTCAAGATCACATGG + Intronic
928395250 2:30938760-30938782 GTGACCTACTCAATAGCACATGG - Intronic
929984919 2:46719645-46719667 GTGAGTTCCTAAAGAGCACCAGG - Intronic
930027512 2:47038297-47038319 GTGACTTGCCCAAGGTCACATGG + Intronic
930152852 2:48076192-48076214 GTGATTTTCCAAAGATCACATGG - Intergenic
931529268 2:63195328-63195350 GTGACCTGCTTAAGATCACATGG - Intronic
931709486 2:64976149-64976171 GTAACTTTCCCAAGATCACAAGG + Intergenic
932008820 2:67954945-67954967 GTGACTTGCCCAAGGTCACATGG - Intergenic
932476860 2:72011722-72011744 GTAACTTACCCAAGTTCACATGG - Intergenic
932707303 2:74036588-74036610 GTAATTGCCTCAAGATCACAAGG - Intronic
935799809 2:106683776-106683798 GTGAGTGAAGCAAGATCTCAGGG - Intergenic
935899939 2:107780716-107780738 GTGAGTCTCCCAAGATCATATGG + Intergenic
936246082 2:110828710-110828732 GTCATTTGCTCAAGATCACATGG + Intronic
936373041 2:111919055-111919077 GTGACTTACACAAGGTCACCTGG + Intronic
938212865 2:129483229-129483251 GTGATTTACTCAAAAGCACTTGG - Intergenic
938979537 2:136513247-136513269 GTGACTTGTTCAAGATCACATGG - Intergenic
940976059 2:159945782-159945804 GTGATGTACTCAACATCAAAAGG + Intronic
941128439 2:161616054-161616076 GTGACTTGCCCAAGGTCACATGG + Intronic
942999808 2:182312369-182312391 TTGCCTAACTCAAGATCACAAGG + Intronic
944014026 2:195010524-195010546 GTGAAATACTCAAGGTCACAGGG - Intergenic
944016266 2:195043062-195043084 GTGAGTTGCTCAAAGTCACATGG - Intergenic
945304050 2:208241807-208241829 ATGATTTACTCAAGACCACATGG - Intronic
945503459 2:210607673-210607695 GTGATGTGCTCAAAATCACACGG - Intronic
945603789 2:211901211-211901233 GTGACTTATTCAAGGTTACAGGG - Intronic
945710908 2:213293108-213293130 GTGAGTATCGCAAGATCTCATGG + Intronic
945975798 2:216269769-216269791 GCCAGTTCCTCAAGGTCACAAGG + Intronic
945978202 2:216286988-216287010 ATGACTCACTCAAGGTCACACGG + Intronic
946565407 2:220959017-220959039 GTGATTTACCCAAAGTCACATGG - Intergenic
946599823 2:221347632-221347654 GTGAGTTGTTCAAGGTCTCATGG - Intergenic
946727408 2:222674081-222674103 GTGAGTTACTCAAGATCACATGG + Intronic
946778759 2:223171454-223171476 GTGAGTTTCTCAAGATCTGAGGG - Intronic
947079822 2:226383594-226383616 GTAACTCACTCAAGATCTCATGG - Intergenic
1168805178 20:668535-668557 GCGACTTACCCAAGGTCACATGG - Intronic
1168833478 20:860521-860543 GTGATTTGCCCAAGGTCACATGG - Intergenic
1168919584 20:1520205-1520227 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1169295187 20:4389894-4389916 GTGAATTCAACAAGATCACAAGG + Intergenic
1170536023 20:17341683-17341705 GTGAGAAACTCAAGAGCACTAGG + Intronic
1170585361 20:17730265-17730287 GTGGATTGCTCAAGATCACATGG + Intronic
1170855154 20:20045767-20045789 GTGACTTATCCAAGATCACATGG - Intronic
1172114601 20:32566223-32566245 GTGATTTGCCTAAGATCACATGG + Intronic
1172254469 20:33505121-33505143 GTGATTTACTCACTGTCACACGG + Intronic
1172282665 20:33719290-33719312 ATGACTTCCTCCAGATCACACGG + Intronic
1172495894 20:35383892-35383914 GTGACTTGCCCAAGGTCACAAGG - Intronic
1172810668 20:37645608-37645630 GTGAGTTACTCAAGGTCGCATGG - Intergenic
1172855791 20:38001315-38001337 TTAACTTACTCAAGGTCACATGG + Intronic
1173740606 20:45398222-45398244 CTGAGTATGTCAAGATCACAAGG - Intronic
1173813474 20:45970546-45970568 GTAGCTTGCTCAAGATCACACGG + Intronic
1173954336 20:47019043-47019065 GTCACTTACCCAAGGTCACACGG + Intronic
1174324065 20:49765012-49765034 GTAATTTGCTCAGGATCACATGG + Intergenic
1174392435 20:50226253-50226275 GTGACATGCTCAAGGTCACATGG + Intergenic
1174412164 20:50343388-50343410 GTGACTTGCCCAAGGTCACACGG + Intergenic
1174994544 20:55551170-55551192 GTGACTTACCCAAGGTCACGTGG - Intergenic
1175045131 20:56097778-56097800 GTGACTTACCCAAGGTCACACGG + Intergenic
1175537853 20:59727602-59727624 GTGACTTGCCCAAGGTCACATGG - Intronic
1175805394 20:61825636-61825658 GTGACTTGCCCAAGATTACAAGG + Intronic
1176372969 21:6073660-6073682 GGGACTCACTCAAGGTCACAGGG - Intergenic
1176913138 21:14592481-14592503 GTGGCTCACTCAAGTTCACATGG - Exonic
1177406144 21:20670992-20671014 GTGAATTATCCAAGATCACAGGG - Intergenic
1178105119 21:29309725-29309747 GTAATTTACAGAAGATCACATGG + Intronic
1178138315 21:29653587-29653609 GAGGGTTACTCAAGGTGACATGG - Intronic
1178235053 21:30832230-30832252 GAGAATTACTGAAGGTCACATGG + Intergenic
1178883860 21:36469516-36469538 GTATCTTACTCAAAATCACACGG + Intronic
1179131103 21:38638174-38638196 GTGACTTGCTCAAGGTCCCATGG - Intronic
1179326623 21:40352742-40352764 GTGAATTACCCAAGATCACATGG - Intronic
1179710655 21:43211268-43211290 GTGACTTATCCAAGGTCACAGGG - Intergenic
1179750508 21:43464583-43464605 GGGACTCACTCAAGGTCACAGGG + Intergenic
1180604956 22:17051140-17051162 GTGCCTTACACAAGATCACAAGG - Intergenic
1181256596 22:21566907-21566929 GTGACTTGCCCAAGGTCACACGG - Intronic
1181905634 22:26193386-26193408 GTAACATACTCAAGATCACAAGG + Intronic
1182044759 22:27265549-27265571 GTGAGTCAGTCAGGATCACATGG - Intergenic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182310149 22:29398580-29398602 GTGACTTGCTCAGGGTCACACGG - Intronic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183492779 22:38125640-38125662 GTGACTTGCTCAAGGTCACACGG - Intronic
1183529908 22:38347725-38347747 GTGACTTGCTCAAGGTCACATGG + Intronic
1183589691 22:38772779-38772801 GGGAGTCACTCAAGGCCACACGG + Intronic
1183596129 22:38813051-38813073 GAGACTTCCCCAAGATCACATGG - Intergenic
1183645829 22:39125776-39125798 GTTAGTTACTCAAGGCTACATGG - Intronic
1183741639 22:39671859-39671881 ATGACTTACTCAAGATCATAAGG + Intronic
1184609130 22:45591194-45591216 GTGAGTTGCTGACAATCACACGG - Intronic
949135585 3:561088-561110 GTAAGTTGCCCAAGGTCACACGG - Intergenic
949183698 3:1165760-1165782 GTGACTTACTCAAGATAACATGG + Intronic
949856431 3:8466103-8466125 GTGATCTACCCAAGGTCACACGG + Intergenic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
950206843 3:11087291-11087313 GTGACTTGCTCAGGTTCACATGG + Intergenic
950554236 3:13685641-13685663 GTGACTTGCCCAAGGTCACATGG - Intergenic
951273315 3:20654467-20654489 GTGATTTACCAAAGATTACAAGG + Intergenic
951358744 3:21700595-21700617 GTGAGTTACTGAATATCACAAGG - Intronic
952323757 3:32301854-32301876 GTGATTTACCCAATGTCACATGG - Intronic
952519185 3:34138247-34138269 GTGACTTATTCAAGCTCATAAGG + Intergenic
953215309 3:40912739-40912761 GTGACTTGCCCAAGGTCACATGG - Intergenic
953750012 3:45601718-45601740 GTGACTTGCTCAAGACCATATGG + Intronic
956104925 3:65807873-65807895 GTAAATTATCCAAGATCACAGGG + Intronic
956182276 3:66528585-66528607 GTAAGTTAATCAAGGTCACCTGG - Intergenic
957024745 3:75168762-75168784 GTAAGTTTCTCAAATTCACAGGG + Intergenic
958664984 3:97126004-97126026 GAGACTTATTCAAGATCAAATGG + Intronic
958827436 3:99048709-99048731 GTGACTTAGTCAAGAGCACATGG + Intergenic
959943090 3:112099953-112099975 GTGACTTGCTCAAGGTCACCTGG + Intronic
960356539 3:116660584-116660606 GTAACTTACTCAAGGTCACTTGG + Intronic
960645404 3:119875579-119875601 GTGACTTACCCAAGATTACATGG - Intronic
960737902 3:120800741-120800763 GTAATTTGCCCAAGATCACATGG + Intergenic
961071325 3:123930626-123930648 CTGACTTACCCAAGATCATATGG + Intronic
961395222 3:126582388-126582410 GTGAGTGACTCGAGAGCAGATGG + Intronic
961566957 3:127770787-127770809 GTGACTTGCCCAAGGTCACAAGG + Intronic
963900245 3:150726663-150726685 GTTACTTACTCAAGTTTACATGG - Intergenic
964519107 3:157543907-157543929 GTGACTTGCCCAAGATCATAAGG - Intronic
964724284 3:159798265-159798287 GTAATTTGCTCAAGGTCACATGG - Intronic
965364752 3:167784672-167784694 GTGAGTTTCACAAGATCTGATGG - Intronic
965727677 3:171736343-171736365 GTCACTCATTCAAGATCACAAGG + Intronic
966031481 3:175353546-175353568 GTGATTTACTCAAGATCACAAGG + Intronic
966338511 3:178898813-178898835 ATGAATTGCTCAAGATTACATGG - Intergenic
966929450 3:184666316-184666338 GTGACTTACCCAAGTTCACAAGG - Intronic
967270863 3:187731219-187731241 GTGAGCTACTCAAGGTTATAGGG - Intronic
967526658 3:190502925-190502947 GAGAGTTGCTTAAGGTCACACGG - Intergenic
967554189 3:190835572-190835594 GTGAGTTTCACAAGATCTGATGG + Intergenic
967970332 3:194994629-194994651 GTGACTTGCTCAAAGTCACACGG - Intergenic
969842112 4:9890345-9890367 GTGTCTTGCCCAAGATCACACGG + Intronic
970631501 4:17951973-17951995 ATGAGTTACTCAAGAAAACTGGG + Intronic
971361683 4:25943875-25943897 GGGACTTACCCAAGATCCCATGG - Intergenic
972425624 4:38929900-38929922 GTGACTTATTCAAGGTTACAAGG - Intronic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
973819261 4:54648403-54648425 GTGACTTACTTGAGATCACCTGG - Intergenic
974353555 4:60782501-60782523 GTGACTTTCCCAAGGTCACATGG - Intergenic
974490972 4:62564195-62564217 TTGACTTACTTAAGATCACATGG - Intergenic
975493758 4:75015739-75015761 GTGCCTCACCCAAGATCACATGG + Intronic
976209021 4:82648798-82648820 GTGTGTAAATCAAGAACACATGG + Intronic
976902201 4:90192237-90192259 GTGAGTTTCACAAGATCTGATGG - Intronic
976917318 4:90392746-90392768 TTGAGTTACTCAAAACCATAAGG + Intronic
977016960 4:91702664-91702686 GTAGGCTAATCAAGATCACAAGG + Intergenic
977491590 4:97720193-97720215 GAGAATTAATCAAGGTCACATGG - Intronic
980674134 4:136052223-136052245 GTGAGTGAATCAAGGTTACATGG + Intergenic
980895832 4:138859189-138859211 GTGATTTGCCCAAGATCAGACGG + Intergenic
981347398 4:143692247-143692269 GTCACTTACTCAAGGTCACACGG + Intronic
981572018 4:146161834-146161856 GTAATTTGCTCAAGATCACATGG - Intergenic
982502517 4:156174502-156174524 GGGAGTTCCTCAAGATAAAATGG - Intergenic
984615391 4:181891297-181891319 GTTAGTTTCTTAAGATGACAAGG - Intergenic
984748720 4:183251049-183251071 GTGACTTGTTCAAGCTCACATGG - Intronic
984969434 4:185174055-185174077 GGGACTTACTCAAGGTCACACGG - Intronic
986381432 5:7190189-7190211 GTGACTTGCCCAAGGTCACATGG + Intergenic
988093878 5:26577103-26577125 GGGACTTGCTCAACATCACAGGG - Intergenic
988797010 5:34660551-34660573 GTGAGTAATCCAAGGTCACACGG - Intronic
989532136 5:42520336-42520358 GGGATTTACACAAGATCACAAGG - Intronic
990478017 5:56180788-56180810 GTGAGTTCAGCAAGGTCACAGGG - Intronic
992197795 5:74356998-74357020 GTGAGGTTCTCAAGATCTCTTGG - Intergenic
992583186 5:78203395-78203417 GTGAGTTTCACAAGATCTGATGG - Intronic
993524942 5:88953760-88953782 GTGAGTTGCACAGGATCACAAGG - Intergenic
993869997 5:93241213-93241235 ATGAGTTACTGAAAATCACATGG - Intergenic
995226443 5:109706503-109706525 GTTACTTCCCCAAGATCACATGG + Intronic
996133931 5:119815816-119815838 GTGATTTTCACAAGGTCACATGG + Intergenic
996825132 5:127674332-127674354 TTGAGTTTCACATGATCACAAGG - Intergenic
997159775 5:131595225-131595247 GTGAGTTCCACAAGATCTGATGG + Intronic
997512907 5:134465638-134465660 GTGACTTGCACAAGGTCACACGG - Intergenic
998796261 5:145822636-145822658 GTGACTTGCTCAAGGTCACATGG - Intronic
998861621 5:146449455-146449477 GTGACTTACACAAGGTCACTGGG + Intronic
999652413 5:153780348-153780370 GCTACTTTCTCAAGATCACATGG - Intronic
1000289533 5:159857697-159857719 GTAAGTAGCACAAGATCACAAGG + Intergenic
1000339796 5:160268341-160268363 GTGACTTACCCCAGACCACATGG - Intronic
1001119593 5:168968844-168968866 GTAACTTACTCAAGGTCACACGG - Intronic
1003047658 6:2748758-2748780 GTGAGGAACTCAAGATCTGAAGG + Intronic
1004342637 6:14820947-14820969 GTCATTTACTCAGGGTCACATGG - Intergenic
1006431775 6:34001735-34001757 GTGACTTGCTCAAGGTCTCATGG + Intergenic
1006738173 6:36289900-36289922 GTGATTTACCCAAAGTCACATGG - Intronic
1006748656 6:36363005-36363027 GTGACTTGCGCAAGATCACATGG - Intronic
1006979685 6:38136988-38137010 GTCAGTTACTCCAGATTCCATGG - Intronic
1007274339 6:40662522-40662544 TTGAGTTGCTCAAGATCAAGGGG - Intergenic
1008136237 6:47780402-47780424 ATGATTTGCTCAAGATCAGAGGG + Intergenic
1008320747 6:50110405-50110427 GTGAGTTACGCAAAATATCAGGG - Intergenic
1011529265 6:88302270-88302292 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1011583881 6:88902992-88903014 ATTAGTTACTCAAGATTTCATGG - Intronic
1012265483 6:97136980-97137002 GTGACTTTCTCAGGGTCACACGG - Intronic
1012529293 6:100214786-100214808 GTAATTTTCTCAAAATCACATGG - Intergenic
1013089372 6:106885859-106885881 GTGAGTTACTCAAAGAAACACGG + Intergenic
1013122653 6:107154935-107154957 ATGAGTGCCTCAAGATCACTGGG - Intronic
1013441352 6:110173510-110173532 GTAATTTGCTCAAGGTCACATGG - Intronic
1014588797 6:123235341-123235363 GTCAGTTTCCCAAGGTCACAGGG - Intronic
1016276281 6:142356735-142356757 GTGACTACCTCAAGGTCACATGG + Intronic
1016319061 6:142822113-142822135 GAGAGTTACTTAAGGTCATATGG - Intronic
1016844547 6:148557993-148558015 ATGAGCTACTGTAGATCACAAGG - Intergenic
1017109458 6:150918832-150918854 GTGAGTTGCCTATGATCACATGG + Intronic
1017646627 6:156545208-156545230 GAGAGTTGCACAAGATCACCAGG - Intergenic
1017780401 6:157711205-157711227 GTGACTTACCCAAGGTCACGTGG - Intronic
1018347506 6:162917132-162917154 GCGAGTTTCTCAAAATAACATGG - Intronic
1018409022 6:163522385-163522407 GTGAGTTGCTCAAGATTACAGGG + Intronic
1020154779 7:5713902-5713924 TTAAATTGCTCAAGATCACAGGG + Intronic
1020222913 7:6255159-6255181 GTAACTTACACAAAATCACAAGG + Intronic
1020375884 7:7486294-7486316 GTGAGTTCAGCAAGGTCACAGGG - Intronic
1020841087 7:13218834-13218856 GTGACTTACTCAAGGTTACAAGG + Intergenic
1021578715 7:22129577-22129599 GTGATATTCTGAAGATCACAGGG - Intronic
1021640104 7:22728233-22728255 GGAATTTACCCAAGATCACAAGG - Intronic
1022171454 7:27836028-27836050 GTGACTTGGCCAAGATCACATGG + Intronic
1022355215 7:29608463-29608485 GTCAGTTACCCAAGGCCACAAGG + Intergenic
1022619786 7:31971391-31971413 ATAACTCACTCAAGATCACATGG - Intronic
1022779482 7:33564414-33564436 GTTACTTACTCAAAATCACATGG - Intronic
1022799361 7:33761097-33761119 GTCACTTCCTCAAGATCACATGG + Intergenic
1022838532 7:34140112-34140134 GTAATTTACTCAATGTCACAGGG - Intronic
1022880826 7:34585564-34585586 GTACGTCACTCAAGGTCACATGG + Intergenic
1026137227 7:67674169-67674191 GTGACTTGCCCAAGGTCACAAGG + Intergenic
1026767599 7:73170277-73170299 CTAAGTTGCCCAAGATCACATGG - Intergenic
1027044067 7:74979985-74980007 CTAAGTTGCCCAAGATCACATGG - Intronic
1027079579 7:75222373-75222395 CTAAGTTGCCCAAGATCACATGG + Intergenic
1027435163 7:78156637-78156659 GTAACTTCCTCAAGGTCACATGG + Intronic
1027994514 7:85408279-85408301 GTGACATGCCCAAGATCACAAGG - Intergenic
1029141921 7:98417449-98417471 GTGACTTACTCCAAGTCACAGGG - Intergenic
1029388799 7:100260965-100260987 CTAAGTTGCCCAAGATCACATGG + Intronic
1029697035 7:102220403-102220425 GTGAGTTTCTCAGCATCAAAGGG - Intronic
1030677138 7:112395662-112395684 GTGAATTTCACAAGATCAGATGG + Intergenic
1030796090 7:113789831-113789853 GTGAGTTTGTCAAGATCACATGG - Intergenic
1031927654 7:127653085-127653107 GTGACTTGCTTAAGGTCACATGG + Intronic
1031958820 7:127970337-127970359 ATGACTTACACAAGGTCACATGG - Intronic
1032382633 7:131500906-131500928 GTGACTTCCTCAAAATCACATGG - Intronic
1033016657 7:137678390-137678412 GAGAGTTTCTCAAGTTAACATGG - Intronic
1033202952 7:139390147-139390169 GTGAATTTCTCAGGATCAAATGG + Intronic
1033521610 7:142166627-142166649 GTGATTTCCTCTAGATTACATGG + Intronic
1033662888 7:143414870-143414892 GTGATTTGCCCAAGATCACTTGG - Intergenic
1034418323 7:150976674-150976696 AAGAGTCACTCAAGGTCACATGG + Intronic
1034563495 7:151896163-151896185 GTGACTCATTCAAGGTCACAGGG + Intergenic
1036017281 8:4799117-4799139 TTGAGTTGATCAAGATCCCAGGG - Intronic
1036492918 8:9244415-9244437 GTGATTTGCCCAAGATCACACGG - Intergenic
1036770930 8:11577998-11578020 GTGAATTGCTCCAGGTCACAAGG + Intergenic
1037438281 8:18887983-18888005 GTGACTTGTCCAAGATCACACGG + Intronic
1037723393 8:21463869-21463891 GAGACTTACTCACTATCACAAGG + Intergenic
1037824266 8:22151668-22151690 GTGCGTTACTGAAGACCAGAGGG + Intronic
1038327868 8:26586225-26586247 GGTAGTGACTCAAGGTCACACGG - Intronic
1039399195 8:37254345-37254367 GGGAGGTACTCAAGACCAGACGG - Intergenic
1039417300 8:37406821-37406843 GTGATTTTCCCAAGGTCACATGG + Intergenic
1041283268 8:56233131-56233153 GTGACTTGCTCAAGTTCACATGG + Intergenic
1041485161 8:58368463-58368485 GTGACTTTCTTAAGGTCACACGG - Intergenic
1041813643 8:61941252-61941274 GTGATTTTCTCAATATCTCAAGG + Intergenic
1042636127 8:70877460-70877482 GTGATTTACTCAAGATCACTTGG + Intergenic
1042923327 8:73941109-73941131 GAGACTTACTCACTATCACAAGG - Intronic
1044241258 8:89891511-89891533 GTAACTTAACCAAGATCACATGG + Intergenic
1045664732 8:104471954-104471976 GTGATTTGCCCAAGATCACATGG + Intergenic
1045743129 8:105385948-105385970 GTAACTTGCTCAAGGTCACATGG - Intronic
1046644029 8:116765752-116765774 GGGAGTTGCCCAAGATCAAACGG + Intronic
1047976382 8:130134578-130134600 GTGACTTACACAAGGTCACACGG + Intronic
1048009049 8:130442299-130442321 CTGACTTGCCCAAGATCACATGG - Intronic
1048334075 8:133490235-133490257 GTGGCTTACTCCAGGTCACATGG + Intronic
1048396679 8:134020631-134020653 GTAACTTGCTCAAGGTCACACGG + Intergenic
1048697797 8:137047863-137047885 GTGAGTCTCACAAGATCTCATGG - Intergenic
1049017383 8:139930413-139930435 GTGGGTGGCTCAGGATCACAGGG + Intronic
1049034908 8:140067658-140067680 GTGACTTGATCAAGGTCACAGGG + Intronic
1049190941 8:141287032-141287054 GCGACTTCCTCAAGGTCACACGG - Intronic
1051536751 9:18167698-18167720 GTGAGTCCCTCAAGAATACATGG - Intergenic
1052036984 9:23693895-23693917 GTGGCTTGCTCAAGACCACAGGG + Intronic
1052112302 9:24601634-24601656 GTGTGTTTTTCAAGAACACAAGG - Intergenic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1054754688 9:68945735-68945757 GTAACTTTCTCAAGACCACATGG + Intronic
1054959817 9:70955585-70955607 GTGGTTTATTCAAGGTCACATGG + Intronic
1055014699 9:71603475-71603497 CTGATTTACTCATGATCACCAGG - Intergenic
1056068948 9:82965930-82965952 GTTATTTACTCAAGGTCACATGG - Intergenic
1058533880 9:105934435-105934457 GTGACTTGCTCAAGGTCATATGG + Intergenic
1058644999 9:107123206-107123228 GTAAATTGCTCAAGAGCACACGG - Intergenic
1058683448 9:107459940-107459962 GTGAGTTCCACAAGGTCCCATGG + Intergenic
1058872294 9:109213036-109213058 ATGACTTTCTCAAGGTCACACGG - Intronic
1059303914 9:113339303-113339325 GTGACTTGCTGAAGGTCACAGGG + Intronic
1059619987 9:115993260-115993282 GTAAGTTGCTCAAGGTCATACGG - Intergenic
1059858271 9:118426633-118426655 GTGAGTTATTCAAGGTTATAGGG + Intergenic
1059959692 9:119552994-119553016 GTGAGTTTCACAAGATCTGATGG - Intergenic
1060451773 9:123749472-123749494 GTGACTTGCCCAAGATCTCAAGG - Intronic
1060845618 9:126834899-126834921 ATGAACTACTCAAGTTCACAGGG - Exonic
1060903484 9:127282507-127282529 GTGATTTTCCCAAGGTCACATGG + Intronic
1061006293 9:127930161-127930183 GTGACTTACCTAAGGTCACAAGG - Intronic
1061209000 9:129179946-129179968 GAGACTTGCCCAAGATCACATGG + Intergenic
1061268725 9:129524110-129524132 GGGACTTGCTCAAGGTCACAAGG - Intergenic
1061710949 9:132487245-132487267 GGGACTTACCCAAGGTCACACGG + Intronic
1062378850 9:136277132-136277154 GTGATTTGTTCAAGGTCACATGG - Intergenic
1185724026 X:2405013-2405035 GTGTGTTCCTGAAAATCACAGGG + Intronic
1186012399 X:5149354-5149376 GTGTGTCACTCTAGTTCACATGG + Intergenic
1187104711 X:16229399-16229421 GTGACTTCCTCAAGGTCACATGG - Intergenic
1187637539 X:21247837-21247859 GTGAGTTTGGCAAGGTCACAGGG + Intergenic
1188028410 X:25235696-25235718 GTGACTTGCACAAGGTCACATGG - Intergenic
1188072712 X:25736770-25736792 GTGATTCACCCAAGGTCACAGGG - Intergenic
1188366423 X:29320882-29320904 ATGAGTTACTCAACATAAAATGG - Intronic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189226284 X:39415908-39415930 GTAACTTGCTCAAGGTCACATGG - Intergenic
1189257498 X:39651925-39651947 GGGACTTATTCAAGTTCACAAGG + Intergenic
1189663852 X:43332178-43332200 GTGACTTTCTTAAGATCTCATGG - Intergenic
1189977426 X:46476643-46476665 GTGAGTAACTCAAGGTCCCATGG + Intronic
1190116726 X:47630170-47630192 GTGACTCACCCAAGGTCACACGG - Exonic
1190969216 X:55332675-55332697 GTAACTTACTCAAGGTCCCATGG + Intergenic
1191951567 X:66598973-66598995 GTTAGTTTCTCAAAGTCACAGGG - Intronic
1191979596 X:66911339-66911361 GTGACTTGCTCAAGTTCACATGG - Intergenic
1192710921 X:73586659-73586681 GTGACTTTCTCAGAATCACATGG + Intronic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1193246054 X:79231678-79231700 GTGTCTTATTCAAGACCACAAGG - Intergenic
1194568263 X:95520922-95520944 GTGAGTCTCACAAGATCTCATGG - Intergenic
1194655967 X:96573777-96573799 GTGACTTTCTCAAGGCCACAAGG - Intergenic
1194779100 X:98000940-98000962 GTGAGTTTATCAAGGTCACCTGG + Intergenic
1195460662 X:105120024-105120046 GTGACTTATCCAAGGTCACATGG + Intronic
1195981798 X:110586485-110586507 GTAACTTACTCGAGGTCACATGG - Intergenic
1197251365 X:124219174-124219196 GTAGGTTACCCAAGGTCACACGG + Intronic
1197958366 X:131977474-131977496 TTGATTTGCTCAAGATCACATGG + Intergenic
1198884785 X:141322611-141322633 GGGAGTTACTCTAGATCAGGTGG + Intergenic
1199088037 X:143651694-143651716 GTGATTTGCTCAAGGTCACATGG + Intergenic
1199683514 X:150243867-150243889 GAGAGTTATTCACTATCACAAGG + Intergenic
1199713698 X:150490967-150490989 GGGACTTTCTCAAGTTCACACGG + Intronic
1199811445 X:151353774-151353796 GTAACTTACCCAAGGTCACACGG - Intergenic
1199971455 X:152864855-152864877 TTGAGTTGCTTAAGATCACTGGG + Intronic
1199982812 X:152930104-152930126 GTAACTTGCTCAAGGTCACATGG + Intronic