ID: 946730192

View in Genome Browser
Species Human (GRCh38)
Location 2:222702004-222702026
Sequence TCCAGGTGCTAGGCAAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946730192 Original CRISPR TCCAGGTGCTAGGCAAATGC AGG Intronic
901756796 1:11446300-11446322 TGCAGGTGCTCAGCACATGCCGG - Intergenic
902226505 1:14999671-14999693 CCCAGTTGCTAAACAAATGCCGG - Intronic
902698298 1:18154965-18154987 AGCAGGGGCTAGGCAAATGGGGG + Intronic
905760338 1:40551151-40551173 CTCAGGGGCAAGGCAAATGCAGG + Intergenic
906897196 1:49788029-49788051 TCAAGGAGCCAGGCAAAGGCCGG + Intronic
907523984 1:55043260-55043282 TCCAGATGCTCTACAAATGCAGG - Intronic
907627693 1:56046661-56046683 GTAAGGTGCTATGCAAATGCTGG - Intergenic
907839212 1:58140355-58140377 TCCATCTGCTTGGCAAGTGCTGG + Intronic
911717911 1:101156117-101156139 TCCAGGATGTAGGCAGATGCAGG - Intergenic
914388832 1:147199411-147199433 TCCAGGTGTTAGAAAAAAGCTGG + Intronic
917895403 1:179482411-179482433 TCTAGGTACTGGGTAAATGCAGG - Intronic
921062027 1:211593328-211593350 TCCAGGAGGTAGGGAAATGTGGG + Intergenic
921698483 1:218239867-218239889 TCCAGGTTTTAGGAAAATGTGGG - Intergenic
921935784 1:220795407-220795429 TCGTGGTGTTATGCAAATGCTGG - Intronic
1065852297 10:29800956-29800978 CCCAGAAGCTAAGCAAATGCTGG - Intergenic
1075908795 10:126105783-126105805 TCCTGGTGAAAGGCAAATCCTGG - Intronic
1084501315 11:69537248-69537270 TCCAGGTGCCTGGCACATGCTGG - Intergenic
1085851519 11:80125445-80125467 GCCAGGAGCTAAGCAGATGCTGG + Intergenic
1088192547 11:107241522-107241544 TCCAGGTCATAGCCAAATGATGG + Intergenic
1091089388 11:132755959-132755981 TCCAGCTGCTAGGAAAATGCAGG + Intronic
1095859772 12:46903921-46903943 ATCAGGTGCTCGGTAAATGCAGG + Intergenic
1097628151 12:62026433-62026455 TCCAGGTTCTTGGCAAAACCTGG + Intronic
1099155203 12:79166746-79166768 TCCAGATGCTATACAAATGTTGG + Intronic
1102702621 12:114852736-114852758 TCTGGGTGCTGGGCACATGCTGG - Intergenic
1105593587 13:21816029-21816051 ACCAGGGGCTAGGGAAATGGTGG - Intergenic
1106112103 13:26786182-26786204 TGCAGGTGATAGGGAAGTGCTGG - Intergenic
1107120234 13:36788245-36788267 TCCAGGTACAAGGGAAATGGTGG - Intergenic
1107210249 13:37844668-37844690 TCTAGGTGAGAGGCAAATGCAGG + Intronic
1107311755 13:39086021-39086043 TCCAGGACCTGGGCAACTGCTGG - Intergenic
1116422546 14:44749570-44749592 ACCAGTTAATAGGCAAATGCAGG - Intergenic
1117823250 14:59673353-59673375 GTCTGGAGCTAGGCAAATGCGGG + Intronic
1119602267 14:75984176-75984198 TTCAGGTGCTAAGCAAGTTCTGG + Intronic
1121534550 14:94682182-94682204 TCCCGGTGTTAGGGAAACGCCGG + Intergenic
1122556447 14:102583304-102583326 TCCGTGTGCTAGGCCAGTGCAGG + Intergenic
1125831103 15:42717767-42717789 TTCAGCTGCCAGGCAACTGCTGG + Exonic
1128367073 15:67012082-67012104 TCCAGGTTCTAAGCAAAGTCTGG - Intergenic
1128670157 15:69568532-69568554 TGCAGGTGCTGGGCTAATTCTGG + Intergenic
1131407917 15:92181819-92181841 TCAGGGTACAAGGCAAATGCTGG + Intergenic
1134104230 16:11474237-11474259 TACAGGTGATATGCAAATGAAGG + Intronic
1134808460 16:17145978-17146000 TCCAGGTCCTAGGACAGTGCAGG + Intronic
1135329904 16:21552187-21552209 GTCAGGGGCTAGGCAAGTGCTGG + Intergenic
1135331707 16:21565835-21565857 TTCTGCTGCTAAGCAAATGCTGG + Intergenic
1135385938 16:22039989-22040011 TCCATGTGCTAGGCACATTCTGG - Intronic
1136340245 16:29638161-29638183 GTCAGGGGCTAGGCAAGTGCTGG + Intergenic
1137304262 16:47183094-47183116 GCCAGGTGCGAGCCAGATGCGGG - Intronic
1140839843 16:78828303-78828325 TCCAGGGGCCAGGCAAAAACTGG + Intronic
1142042928 16:87906702-87906724 GTCAGGGGCTAGGCAAGTGCTGG + Intronic
1142533897 17:599985-600007 GTCAGGTGCTGGGAAAATGCTGG - Intronic
1143753677 17:9050852-9050874 ACCAGGTGCTCAGGAAATGCTGG + Intronic
1146398043 17:32484314-32484336 TGAAGGTGCTAGGGAAAGGCTGG + Intergenic
1151207396 17:72518028-72518050 TCCAGGTACCAGGCCACTGCTGG + Intergenic
1152485928 17:80592852-80592874 TCCAGGCGCCAGGGAAACGCAGG - Intronic
1154008761 18:10558150-10558172 GCCAGGTGCTTGGAAAATTCTGG - Intergenic
1155334037 18:24746909-24746931 TCCAGGTGCTAGGAACATTGTGG + Intergenic
1155538107 18:26838900-26838922 TCTATGTGCTATGCACATGCTGG + Intergenic
1156399061 18:36724548-36724570 TCCAGCTTCTAGGAAGATGCAGG - Intronic
1158426805 18:57347712-57347734 TCAAGGTGTTAGGCAACAGCCGG + Intergenic
1159029456 18:63216042-63216064 TCTAAGTGCTAGGCAAAGACAGG + Intronic
1160293159 18:77613384-77613406 TCCAGGTGCTAGGTAGAGCCAGG + Intergenic
1160607249 18:80060542-80060564 TCCATGAACTAGGCAACTGCTGG + Intronic
1161682298 19:5686411-5686433 CCCAGGTGGTAGGGAACTGCCGG + Exonic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1166368404 19:42288785-42288807 TCTAGGTACTAGGCAGAAGCAGG - Intronic
925440006 2:3877542-3877564 TCCAGGTGCCAGGCTTGTGCTGG + Intergenic
925789452 2:7469183-7469205 TCCAGGTGCCAGAAAATTGCAGG - Intergenic
927086312 2:19676945-19676967 TCCAGGGGCCAGGCAAACACTGG - Intergenic
928920030 2:36517363-36517385 TCCAGGGGCGTGGCAAATGGAGG - Exonic
930425063 2:51202683-51202705 ACCAGGTGGTAGGCAAACGCAGG - Intergenic
932423741 2:71616053-71616075 CCCAGGACCTAGGCAGATGCTGG - Intronic
937062295 2:118989608-118989630 TGCAGGTGCTTGGGAAATCCAGG + Intronic
938580555 2:132642426-132642448 TCCAGGTACAAGGCAAAGGCAGG - Intronic
941951998 2:171165343-171165365 TTCAGGTGATAGGGCAATGCAGG + Intronic
942444844 2:176071050-176071072 TGCAGGTGATAGGTGAATGCAGG + Intergenic
944589076 2:201200504-201200526 TCCTGGAGCTTGGCAAAGGCTGG + Intronic
945573212 2:211497024-211497046 TCTAGGTGCTAGGGACATACTGG - Intronic
946730192 2:222702004-222702026 TCCAGGTGCTAGGCAAATGCAGG + Intronic
946864219 2:224028212-224028234 TCAAGTTGCTTGGCAAAGGCAGG - Intronic
948067507 2:235092194-235092216 GCCACCTTCTAGGCAAATGCCGG - Intergenic
1170102364 20:12716384-12716406 ACCAGAAGCTAGGAAAATGCAGG + Intergenic
1173726956 20:45304940-45304962 CCCAGGTGCTAGGCACATGCCGG - Intronic
1176667409 21:9700285-9700307 TCCAGGTGCTAGGTACCTCCAGG - Intergenic
1178865732 21:36325778-36325800 TCCAGGTGCTACTCAGATGGGGG - Intronic
1184496943 22:44847582-44847604 CCCAGGTGCCAGGCACTTGCTGG + Intronic
1185067537 22:48639664-48639686 TCCAGGTGCTAGGCGGGGGCTGG - Intronic
952035529 3:29196206-29196228 TCCAGGTACTAGGCAAGCACTGG - Intergenic
954671756 3:52294764-52294786 TCCAAGTTCCAGGCAAAAGCAGG + Intergenic
954766514 3:52922612-52922634 GCCAGGTACTAGGCAACTGGAGG + Intronic
961065302 3:123870123-123870145 TCCAGGTGCCAGCCCAGTGCTGG - Intronic
963736750 3:149025969-149025991 GCCAAGTGCAAGGCAAAGGCAGG + Intronic
964711931 3:159680139-159680161 TCCAGGTGCTGGGGATATGGTGG - Intronic
966602902 3:181793367-181793389 CCCAGGTGCTACGAAAATACCGG - Intergenic
967137599 3:186525580-186525602 TGCAAGTGCTATGCAAATGGAGG - Intergenic
969549739 4:7856814-7856836 TGCAGATGCTGGGCGAATGCTGG - Intronic
969607275 4:8208768-8208790 TGCAGGTGGTCAGCAAATGCGGG + Intronic
970477917 4:16442744-16442766 TCCAGGTGCTAGGCAGTGACAGG + Intergenic
975975228 4:80087941-80087963 ACCAGGAGCTAGGTAGATGCTGG - Intronic
976202337 4:82591779-82591801 TCCAGGTGCTATCCAAATACTGG + Intergenic
979344526 4:119571218-119571240 TCCATGTGGTAGGCAAATAATGG + Intronic
979504162 4:121476326-121476348 TCTAGGTGCCAGCCACATGCTGG - Intergenic
981392983 4:144214136-144214158 TCCAGGTGTTAGAAAAATGGTGG + Intergenic
982112428 4:152069342-152069364 TGCAGGTGCTAGGCCGAGGCAGG + Intergenic
988937940 5:36107944-36107966 TCAAGGTCCTAGGCAAAAACTGG + Intronic
989131969 5:38115629-38115651 TCAAGGTGCCAGGAAACTGCTGG + Intergenic
989363211 5:40626711-40626733 TCCAGAAGCCAGGCAGATGCTGG + Intergenic
989638766 5:43563286-43563308 TCCAGGTGCTGAGGATATGCAGG + Intergenic
990784782 5:59407319-59407341 TCCAGAAGCTTAGCAAATGCTGG + Intronic
997267282 5:132502208-132502230 TCCAGGTGCCAGGGTCATGCAGG - Intergenic
998958063 5:147456962-147456984 TTCAGGTGATAGCCAAATGATGG - Intronic
999012031 5:148053612-148053634 ACACAGTGCTAGGCAAATGCAGG + Intronic
999495682 5:152094536-152094558 TCTAGGTGCTTGGAAAATGCTGG - Intergenic
1001179046 5:169501440-169501462 TCCAGTGGCTAGGCAACTGCAGG + Intergenic
1003749194 6:9037674-9037696 TCCAGATGGAAGGGAAATGCTGG - Intergenic
1005216777 6:23537862-23537884 TCCAGGTGTTAGGCAGAAGAAGG - Intergenic
1005557935 6:27007249-27007271 TCCAGGGGCCTAGCAAATGCTGG - Intergenic
1007961900 6:45967691-45967713 ACCAGAAGCTAAGCAAATGCTGG - Intronic
1010147474 6:72687617-72687639 TTGAAGTGCTAGGCAAATGATGG + Intronic
1012018862 6:93890266-93890288 TCCAGGTGGTTTGAAAATGCTGG + Intergenic
1016501499 6:144725658-144725680 ACCAGGTGGTTGGGAAATGCAGG + Intronic
1017256649 6:152340841-152340863 TCCAGGTGTTAGGCTACTGCAGG + Intronic
1018921969 6:168181635-168181657 TGCAGGTGCTCAGTAAATGCTGG - Intergenic
1019725587 7:2600588-2600610 TTTAGGTGCTAAGCAGATGCTGG + Intronic
1029258264 7:99284125-99284147 GCCAGGTGCTTGGGACATGCAGG - Intergenic
1030222897 7:107116215-107116237 TCTAGGTGCTAGGAAAATAGAGG + Intronic
1030822770 7:114115839-114115861 ACCAGGTGCCATGCAAGTGCTGG - Intronic
1032744801 7:134774796-134774818 TCCAGATGTTAGGCAAATTTTGG - Intronic
1041730928 8:61061875-61061897 CCCAGGTGCTACGGATATGCTGG - Intronic
1045124602 8:99075274-99075296 CCCAGAAGCTAGGCAGATGCCGG - Intronic
1048265010 8:132978129-132978151 TCCAGAAGCTGGGCAGATGCTGG - Intronic
1048551409 8:135436840-135436862 GGCAGGTTCTATGCAAATGCTGG + Intergenic
1051432665 9:16996075-16996097 TCCAAAAGATAGGCAAATGCTGG + Intergenic
1052864300 9:33455784-33455806 TGCAGGGGCCAGGCTAATGCTGG - Intergenic
1053149280 9:35732477-35732499 CCCAGGGGCTATGCAAATGTAGG - Exonic
1053411863 9:37920986-37921008 TGCTGGGGCTAGGCAAATGCTGG - Intronic
1053435578 9:38071713-38071735 TCCATGTGCAAGACACATGCAGG - Intergenic
1055574093 9:77645781-77645803 ACCAGGAGCTTGACAAATGCTGG - Intronic
1056231165 9:84545969-84545991 CCCAGGTGCCAGGGAAATCCTGG - Intergenic
1058597357 9:106629466-106629488 TCCAGAAGCCAAGCAAATGCTGG + Intergenic
1061265283 9:129501200-129501222 TGCAAGGGCTGGGCAAATGCTGG - Intergenic
1203658406 Un_KI270753v1:20413-20435 TCCAGGTGCTAGGTACCTCCAGG + Intergenic
1187710176 X:22045446-22045468 TCCAGCTGCCATGCAATTGCTGG - Intronic
1189251466 X:39603495-39603517 GCCAAGAGTTAGGCAAATGCAGG + Intergenic
1197846763 X:130811234-130811256 TGCAGGGGCTAGCCAGATGCTGG - Intronic
1199724423 X:150567095-150567117 TCCAGGAGTTTGGCAAATCCAGG + Intergenic