ID: 946731327

View in Genome Browser
Species Human (GRCh38)
Location 2:222712304-222712326
Sequence CTGGATAACCCAGCGGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946731327_946731331 8 Left 946731327 2:222712304-222712326 CCAACATCCGCTGGGTTATCCAG 0: 1
1: 0
2: 0
3: 5
4: 59
Right 946731331 2:222712335-222712357 TAAAGCCCGTGCTTGTAAATCGG 0: 1
1: 0
2: 0
3: 2
4: 55
946731327_946731332 11 Left 946731327 2:222712304-222712326 CCAACATCCGCTGGGTTATCCAG 0: 1
1: 0
2: 0
3: 5
4: 59
Right 946731332 2:222712338-222712360 AGCCCGTGCTTGTAAATCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946731327 Original CRISPR CTGGATAACCCAGCGGATGT TGG (reversed) Intergenic
901137345 1:7006587-7006609 CTGGAGAACCCAGTTGAGGTGGG + Intronic
911354483 1:96799159-96799181 CTGGGTGACCCAGCTGATGAGGG + Intronic
912555797 1:110515123-110515145 CATGATAAGCCAGCTGATGTGGG - Intergenic
915537823 1:156548169-156548191 CTGGATAACAAAGCCGACGTTGG + Exonic
917461310 1:175232681-175232703 CTGTATAACCCATGGGATCTAGG - Intergenic
924421356 1:243913109-243913131 CTGAATAACCTAGAGGATGGTGG + Intergenic
1065369401 10:24968441-24968463 CTGGATGAGCAAGGGGATGTTGG - Intergenic
1069595263 10:69666084-69666106 CTGGGGGATCCAGCGGATGTGGG + Intergenic
1071241484 10:83710734-83710756 CTGGAAGACCCAGAGGCTGTGGG - Intergenic
1071759097 10:88580122-88580144 CTGGATCACCCTGCAGATCTTGG + Intronic
1078340594 11:10495697-10495719 CTGGATGATCCAGCGCATGTTGG - Exonic
1079242031 11:18728258-18728280 ATGGAGAACCCAGAGGATCTAGG - Exonic
1089663603 11:120002206-120002228 CTGGTTTACCCAGAGGATGGTGG - Intergenic
1096599053 12:52716491-52716513 CAGGATGACCCAGAGGCTGTGGG - Intergenic
1102589812 12:113948788-113948810 GTGGATAGCCCAGCGGCTATGGG - Intronic
1107113694 13:36724370-36724392 TTGGAAAACCCAGGGCATGTAGG - Intergenic
1129856036 15:78825925-78825947 CTGGAGAGCCCAGAGGAAGTGGG - Intronic
1132755480 16:1482476-1482498 CTGGAAAGCCCCGCGGATGCCGG - Intergenic
1141869968 16:86778626-86778648 CTGGAGAACCCAGAGGAAGGGGG - Intergenic
1142035951 16:87862203-87862225 CTGGATACCCCAGCGGTTGGGGG + Intronic
1142193032 16:88726587-88726609 CTGGATGACCCAGCAGAAGCCGG + Exonic
1161131007 19:2588688-2588710 CTGGGTAACCCAGCTGGGGTTGG - Intronic
1161174654 19:2834018-2834040 CTGCATATCCCAGCTGATGGTGG - Exonic
1168268230 19:55234935-55234957 CTGGCTAACAGAGGGGATGTGGG + Intronic
926047256 2:9718658-9718680 CTGGATAACCACACAGATGTGGG - Intergenic
928421016 2:31137993-31138015 CTGGGTAACCAAGAGGAAGTTGG - Exonic
935935508 2:108178066-108178088 CTGGATAACTCTGAGGAGGTAGG - Intergenic
946726391 2:222665612-222665634 TTGGATAACTCAGTGGATGGTGG - Intergenic
946731327 2:222712304-222712326 CTGGATAACCCAGCGGATGTTGG - Intergenic
1170769923 20:19323632-19323654 CTGGTGAACCCACTGGATGTGGG - Intronic
1174918543 20:54677927-54677949 TTGCACAACCCAGCTGATGTGGG - Intergenic
1180224797 21:46386022-46386044 CTGCATGACCCAGCGGGTGCTGG - Intronic
1182079393 22:27518466-27518488 CTGGTTCATCCAGGGGATGTTGG - Intergenic
949253116 3:2011324-2011346 CTTGAGAACCCTGCTGATGTGGG - Intergenic
951805806 3:26642484-26642506 CTTCATAACCCATAGGATGTGGG + Intronic
952421096 3:33132090-33132112 CTGGAAAACCCAAAGGATGGTGG - Intronic
954297260 3:49681177-49681199 CCGGATGCCCCAGTGGATGTCGG - Exonic
956793688 3:72699895-72699917 CTGGATAACGCAGCCTTTGTTGG - Intergenic
959228434 3:103616462-103616484 CTGGATAACTCATTGGATGTTGG + Intergenic
963008654 3:140749625-140749647 ATGGATAAACCAGAGCATGTGGG - Intergenic
963861077 3:150311308-150311330 CTGGATAAGCCTGGGGCTGTGGG - Intergenic
970038006 4:11761639-11761661 CTGGATGACACAGCTGAGGTGGG - Intergenic
980979176 4:139639356-139639378 CTGGAAAACTCAGCCCATGTGGG + Intergenic
986006367 5:3672256-3672278 CTGGATAACCCCGGGGCTGGTGG + Intergenic
989519473 5:42383724-42383746 ATGGATAACCCTGAGGATGCTGG - Intergenic
993095607 5:83474561-83474583 CTGGCTAACCCAGCCGCTGCGGG - Intronic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
996934667 5:128934793-128934815 CTGGAGAACACAAAGGATGTTGG + Intronic
998587498 5:143442811-143442833 CTTGACAACCCAGCTGATGCAGG + Intergenic
1004519913 6:16352159-16352181 CTGGTTAACCCAAGGGATGGTGG + Intronic
1005237685 6:23784546-23784568 CTGGATAACCCAGGGCACGTTGG - Intergenic
1032156661 7:129475175-129475197 CTGGAGAAGGCAGTGGATGTGGG + Intronic
1032543033 7:132720035-132720057 CTGGACAAGGCAGCCGATGTGGG + Intronic
1035627870 8:1087321-1087343 CTGGAGGACACAGCGGATGAAGG - Intergenic
1043796361 8:84546768-84546790 CTGGATAACCAAGTGTATCTAGG + Intronic
1045224796 8:100233926-100233948 ATGGGTGACCCAGCGGAAGTTGG + Intronic
1047524220 8:125618678-125618700 CAGGATAACCCAAAGGATGGAGG - Intergenic
1048475921 8:134742333-134742355 CTGGTTGACCCAGCGGTTCTGGG - Intergenic
1051895248 9:21979788-21979810 CTGGAGAACCCAGCTGAGGGTGG + Intronic
1055462753 9:76534516-76534538 CTGGTTTACCCTGTGGATGTTGG + Intergenic
1057540537 9:95964424-95964446 CTGGATAACCCAGGTGGTTTGGG - Intronic
1060407867 9:123381719-123381741 CTGGGGGACCCAGCGGCTGTAGG + Exonic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1191662405 X:63665252-63665274 CTGGATAACTCTGTGTATGTTGG - Intronic
1192065099 X:67875535-67875557 CTGGAAAACCTAGAGGAAGTGGG - Intergenic