ID: 946731333

View in Genome Browser
Species Human (GRCh38)
Location 2:222712340-222712362
Sequence TGCCTCCGATTTACAAGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946731333 Original CRISPR TGCCTCCGATTTACAAGCAC GGG (reversed) Intergenic
907068513 1:51511534-51511556 TGCCTCTGGTTTAGAATCACTGG - Intronic
920614340 1:207474844-207474866 TGCTTCCCATTGACAATCACTGG - Exonic
924042975 1:240001932-240001954 TGCCTACTATTTAAACGCACTGG + Intergenic
1069984722 10:72275281-72275303 TGCCTCAGTTTTCCAACCACAGG - Exonic
1073044990 10:100631826-100631848 TGCCTCCGATCTTCAAGGATCGG - Intergenic
1079992972 11:27266140-27266162 TCCCACTGATTTACATGCACAGG + Intergenic
1081988209 11:47322875-47322897 TGCCTCCATCTTACAAGCTCAGG - Intronic
1095365341 12:41397373-41397395 TGCCAGTCATTTACAAGCACAGG - Intronic
1096441495 12:51647388-51647410 TGCCTCTGATTCTCAAGAACTGG - Intronic
1097333886 12:58360736-58360758 TGCTTGCTATTTACAGGCACTGG - Intergenic
1098458447 12:70703466-70703488 TGCCTCCTACTCAGAAGCACAGG - Intronic
1114341550 14:21750655-21750677 TGCCTCAGCCTTACCAGCACTGG + Intergenic
1120834629 14:89028547-89028569 TGCCTCAGAACTACAAGAACAGG - Intergenic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1129071400 15:72954298-72954320 AGCCTCCCATGTACAAGGACAGG + Intergenic
1132145035 15:99424559-99424581 TCCCTCCCACTTGCAAGCACAGG - Intergenic
1133706090 16:8356068-8356090 TGCCCCCAAAATACAAGCACTGG + Intergenic
1134661987 16:15991244-15991266 TCCCTGCGATTTAGAGGCACAGG - Intronic
1134837979 16:17377743-17377765 TGCCTGTGAGTTTCAAGCACTGG + Intronic
1138056697 16:53842001-53842023 TGCCTCAAATTTACAACCAAAGG - Intronic
1139062286 16:63267051-63267073 TTCTGCCGATTTCCAAGCACAGG - Intergenic
1139176820 16:64699325-64699347 TGCCTCTGATTTAAAACCACTGG + Intergenic
1157493950 18:48142323-48142345 TGCCTCCCATTTAGGAGCACTGG + Intronic
1158153295 18:54396275-54396297 AGCCTGCAAGTTACAAGCACAGG + Intergenic
1158851860 18:61502813-61502835 TACCTCAAATTTAAAAGCACAGG + Intronic
1159681933 18:71365133-71365155 TGACTTCGATTTATATGCACTGG - Intergenic
928674763 2:33639498-33639520 TGCCTCAGCTTCCCAAGCACTGG - Intergenic
939701197 2:145393311-145393333 TGCCTCAGAATTGCAAGCTCAGG + Intergenic
943793965 2:191968494-191968516 GGCCTGCAATTTAGAAGCACAGG - Intronic
944870956 2:203911393-203911415 TGCCTCAGATCATCAAGCACTGG + Intergenic
946731333 2:222712340-222712362 TGCCTCCGATTTACAAGCACGGG - Intergenic
947475904 2:230447502-230447524 AACCTCCAATTTACAGGCACAGG - Intronic
947504039 2:230693388-230693410 TGCCTCCTCTGTACAGGCACTGG + Intergenic
1171121551 20:22572971-22572993 TGCCTCCTACTTTCCAGCACTGG + Intergenic
1173190677 20:40873327-40873349 TGCCTCCAATTGAGAACCACTGG + Intergenic
1176007011 20:62870979-62871001 TGCCTTTGATTTAAAAGCATTGG + Intergenic
949334390 3:2958194-2958216 TGCCTCCAATTAAGAAACACTGG + Intronic
954784602 3:53083628-53083650 TGCCGCAGATCTGCAAGCACAGG - Intronic
955078207 3:55633648-55633670 TGCCTGCTATTTGCAAACACTGG + Intronic
960353083 3:116617452-116617474 TGTCTCCTATTTCCAAGCAAAGG - Intronic
962044127 3:131737570-131737592 TGCCTACATTTTACAAGCACAGG + Intronic
966475043 3:180335162-180335184 TGCCTTTGATTTCCAGGCACAGG + Intergenic
966684390 3:182678292-182678314 TGCCTCCGCTTCCCAAGCAGTGG + Intergenic
971797835 4:31251683-31251705 TGCCTCAGCCTTCCAAGCACTGG + Intergenic
974869478 4:67622008-67622030 TGTCTCAGAGTTACAAGCAGAGG + Intronic
975399709 4:73920501-73920523 TGCCTGCTATTTGCAGGCACTGG - Intergenic
977028051 4:91846161-91846183 GGCCCCAGATTTACAAGCCCAGG + Intergenic
982616278 4:157639982-157640004 TGCCTCTGGGTTAAAAGCACTGG - Intergenic
986541718 5:8851318-8851340 TGCCTCCGGTCTTCAAGCCCAGG + Intergenic
990149834 5:52803874-52803896 TGCCAGAGATTTACCAGCACAGG - Exonic
990752185 5:59028848-59028870 TGCCTACCATTTACTAACACTGG - Intronic
991426893 5:66500941-66500963 TGGCTCATATTTACATGCACAGG - Intergenic
1000201838 5:159018741-159018763 TGCCTCCATTTTACAGGAACAGG + Intronic
1002644251 5:180645457-180645479 TGGCCCCGATTTAGCAGCACTGG - Intronic
1024872677 7:53984176-53984198 TTCCTCCGGATTACAAGGACTGG + Intergenic
1025766769 7:64463465-64463487 TGCCTCCGTTTTAAAATCCCAGG + Intergenic
1027893689 7:84012492-84012514 TGCCTACTGTGTACAAGCACTGG - Intronic
1032552572 7:132798625-132798647 TGTCTCAGATTTAAAAGCAGGGG + Intronic
1037170322 8:15884957-15884979 ACCCTCTGATTTGCAAGCACAGG - Intergenic
1038579720 8:28737425-28737447 TGCCTCCACCTTACAAGCTCTGG - Intronic
1039630134 8:39102173-39102195 TGCATACGATTTAGAAGCAAGGG + Intronic
1042282256 8:67066874-67066896 TGCTTCCCATTTTCAAGCAATGG + Intronic
1044651180 8:94497514-94497536 TGCCTCCGGGGTTCAAGCACTGG + Intronic
1059509018 9:114826651-114826673 TGCCTACAATCTACAATCACAGG - Intergenic
1062336933 9:136075403-136075425 CGCCTCCGAGTTCCAAGCCCGGG - Intronic
1189050360 X:37638504-37638526 TGCCTCCTACTTACAACCAAAGG + Intronic
1195246407 X:102999382-102999404 TGCCTCAGAATTCCAGGCACAGG - Intergenic