ID: 946735924

View in Genome Browser
Species Human (GRCh38)
Location 2:222754472-222754494
Sequence CAACAAGATGTGGTCTAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946735924_946735933 21 Left 946735924 2:222754472-222754494 CCCCATTAGACCACATCTTGTTG No data
Right 946735933 2:222754516-222754538 CCAGCTCCTGCAATTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946735924 Original CRISPR CAACAAGATGTGGTCTAATG GGG (reversed) Intergenic
No off target data available for this crispr