ID: 946735927

View in Genome Browser
Species Human (GRCh38)
Location 2:222754474-222754496
Sequence GCCAACAAGATGTGGTCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946735927_946735933 19 Left 946735927 2:222754474-222754496 CCATTAGACCACATCTTGTTGGC No data
Right 946735933 2:222754516-222754538 CCAGCTCCTGCAATTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946735927 Original CRISPR GCCAACAAGATGTGGTCTAA TGG (reversed) Intergenic
No off target data available for this crispr