ID: 946735930

View in Genome Browser
Species Human (GRCh38)
Location 2:222754482-222754504
Sequence TGACCCTGGCCAACAAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946735930_946735935 24 Left 946735930 2:222754482-222754504 CCACATCTTGTTGGCCAGGGTCA No data
Right 946735935 2:222754529-222754551 TTGTCCCTGGCCTGTTGTAGTGG No data
946735930_946735933 11 Left 946735930 2:222754482-222754504 CCACATCTTGTTGGCCAGGGTCA No data
Right 946735933 2:222754516-222754538 CCAGCTCCTGCAATTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946735930 Original CRISPR TGACCCTGGCCAACAAGATG TGG (reversed) Intergenic
No off target data available for this crispr