ID: 946735931

View in Genome Browser
Species Human (GRCh38)
Location 2:222754496-222754518
Sequence TGGCAAGAGAACTGTGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946735931_946735933 -3 Left 946735931 2:222754496-222754518 CCAGGGTCACAGTTCTCTTGCCA No data
Right 946735933 2:222754516-222754538 CCAGCTCCTGCAATTGTCCCTGG No data
946735931_946735935 10 Left 946735931 2:222754496-222754518 CCAGGGTCACAGTTCTCTTGCCA No data
Right 946735935 2:222754529-222754551 TTGTCCCTGGCCTGTTGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946735931 Original CRISPR TGGCAAGAGAACTGTGACCC TGG (reversed) Intergenic
No off target data available for this crispr