ID: 946735933

View in Genome Browser
Species Human (GRCh38)
Location 2:222754516-222754538
Sequence CCAGCTCCTGCAATTGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946735924_946735933 21 Left 946735924 2:222754472-222754494 CCCCATTAGACCACATCTTGTTG No data
Right 946735933 2:222754516-222754538 CCAGCTCCTGCAATTGTCCCTGG No data
946735925_946735933 20 Left 946735925 2:222754473-222754495 CCCATTAGACCACATCTTGTTGG No data
Right 946735933 2:222754516-222754538 CCAGCTCCTGCAATTGTCCCTGG No data
946735931_946735933 -3 Left 946735931 2:222754496-222754518 CCAGGGTCACAGTTCTCTTGCCA No data
Right 946735933 2:222754516-222754538 CCAGCTCCTGCAATTGTCCCTGG No data
946735927_946735933 19 Left 946735927 2:222754474-222754496 CCATTAGACCACATCTTGTTGGC No data
Right 946735933 2:222754516-222754538 CCAGCTCCTGCAATTGTCCCTGG No data
946735930_946735933 11 Left 946735930 2:222754482-222754504 CCACATCTTGTTGGCCAGGGTCA No data
Right 946735933 2:222754516-222754538 CCAGCTCCTGCAATTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946735933 Original CRISPR CCAGCTCCTGCAATTGTCCC TGG Intergenic
No off target data available for this crispr