ID: 946739116

View in Genome Browser
Species Human (GRCh38)
Location 2:222784737-222784759
Sequence CTCTTTGAACAAATGGATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946739116_946739126 19 Left 946739116 2:222784737-222784759 CCTAGATCCATTTGTTCAAAGAG No data
Right 946739126 2:222784779-222784801 GGCCTATGAAGAGGATTTTGGGG No data
946739116_946739124 17 Left 946739116 2:222784737-222784759 CCTAGATCCATTTGTTCAAAGAG No data
Right 946739124 2:222784777-222784799 AGGGCCTATGAAGAGGATTTTGG No data
946739116_946739125 18 Left 946739116 2:222784737-222784759 CCTAGATCCATTTGTTCAAAGAG No data
Right 946739125 2:222784778-222784800 GGGCCTATGAAGAGGATTTTGGG No data
946739116_946739119 -2 Left 946739116 2:222784737-222784759 CCTAGATCCATTTGTTCAAAGAG No data
Right 946739119 2:222784758-222784780 AGCTTATGTCCTTCAGCCCAGGG No data
946739116_946739118 -3 Left 946739116 2:222784737-222784759 CCTAGATCCATTTGTTCAAAGAG No data
Right 946739118 2:222784757-222784779 GAGCTTATGTCCTTCAGCCCAGG No data
946739116_946739121 10 Left 946739116 2:222784737-222784759 CCTAGATCCATTTGTTCAAAGAG No data
Right 946739121 2:222784770-222784792 TCAGCCCAGGGCCTATGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946739116 Original CRISPR CTCTTTGAACAAATGGATCT AGG (reversed) Intergenic
No off target data available for this crispr