ID: 946740106

View in Genome Browser
Species Human (GRCh38)
Location 2:222792868-222792890
Sequence GTGAAGAAGGAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946740106_946740112 0 Left 946740106 2:222792868-222792890 CCCTCCTCCTCCTCCTTCTTCAC No data
Right 946740112 2:222792891-222792913 TAAAATGTTATGTCTGAGCATGG No data
946740106_946740113 19 Left 946740106 2:222792868-222792890 CCCTCCTCCTCCTCCTTCTTCAC No data
Right 946740113 2:222792910-222792932 ATGGTCAATCAAAATTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946740106 Original CRISPR GTGAAGAAGGAGGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr