ID: 946743658

View in Genome Browser
Species Human (GRCh38)
Location 2:222825250-222825272
Sequence CAGGGTAGAAACTCAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946743649_946743658 22 Left 946743649 2:222825205-222825227 CCACTCAAACTTCAAAATTTCTG No data
Right 946743658 2:222825250-222825272 CAGGGTAGAAACTCAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946743658 Original CRISPR CAGGGTAGAAACTCAGTGGC TGG Intergenic
No off target data available for this crispr