ID: 946747606

View in Genome Browser
Species Human (GRCh38)
Location 2:222861333-222861355
Sequence CCGAGGGGCTCCCCAGCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946747599_946747606 -2 Left 946747599 2:222861312-222861334 CCGCGTGCGGTTCGGCTGGGCCC 0: 1
1: 0
2: 0
3: 6
4: 45
Right 946747606 2:222861333-222861355 CCGAGGGGCTCCCCAGCCTCGGG 0: 1
1: 0
2: 2
3: 22
4: 268
946747597_946747606 1 Left 946747597 2:222861309-222861331 CCTCCGCGTGCGGTTCGGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 33
Right 946747606 2:222861333-222861355 CCGAGGGGCTCCCCAGCCTCGGG 0: 1
1: 0
2: 2
3: 22
4: 268
946747593_946747606 17 Left 946747593 2:222861293-222861315 CCGGTTGGCGGCGCGGCCTCCGC 0: 1
1: 0
2: 1
3: 9
4: 89
Right 946747606 2:222861333-222861355 CCGAGGGGCTCCCCAGCCTCGGG 0: 1
1: 0
2: 2
3: 22
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946747606 Original CRISPR CCGAGGGGCTCCCCAGCCTC GGG Intronic
900142542 1:1144728-1144750 TCGAGGGGCTCTACAGCCTGTGG + Intergenic
900759373 1:4460756-4460778 GCAAGGCCCTCCCCAGCCTCCGG - Intergenic
900990367 1:6095811-6095833 TAGAGGGGCTGCCCAGCCTGTGG + Intronic
901026279 1:6280299-6280321 CCCAGGGGCTCTGCAGCCTTTGG - Intronic
901045304 1:6392754-6392776 CCGAGGGGCTCGCGCGGCTCTGG + Intronic
901664494 1:10818745-10818767 CCGGGGCACTCCCCAGTCTCTGG - Intergenic
902070253 1:13728522-13728544 CCCTGGGGCTGCCCAGCGTCTGG + Intronic
903138888 1:21326841-21326863 GAGAGGGTCTCCCCAGCCTTTGG + Intronic
903191097 1:21656592-21656614 CCTGGGGGTTCCCCAGCCCCTGG + Intronic
904439638 1:30521937-30521959 TCAAGGGGCTCCTCATCCTCTGG + Intergenic
905891675 1:41522069-41522091 AGGAGGGGCTCCCCAGGCCCTGG + Intronic
906888974 1:49686303-49686325 CCGAGGTGTTCCCCATCCACTGG - Intronic
906956934 1:50382012-50382034 CAGAGGGGCTCCCCACCTCCCGG - Intergenic
910009721 1:82446479-82446501 CCCAGAGGCTCTCCTGCCTCTGG + Intergenic
911188741 1:94927371-94927393 CCTGGGGGCTTCCCAGCCACAGG + Intergenic
913429652 1:118776623-118776645 CCGAGGGGCAAAACAGCCTCTGG + Intergenic
914702897 1:150150205-150150227 CCGAGGGGCGGCCCCGCGTCGGG - Exonic
919075499 1:192808624-192808646 CTGACGGGCTCCCCAGCCCGAGG - Intergenic
919748642 1:201023541-201023563 CCGAGGGGCTCACCCGCGGCCGG + Exonic
919942284 1:202296509-202296531 CCCCGGGGCTCCCCTGCCTTTGG + Intronic
920352042 1:205343853-205343875 CGGATGGGCTCCGCAGCCCCTGG + Intronic
921020070 1:211227124-211227146 TCGATTGGCTCCCCATCCTCTGG - Intergenic
924584956 1:245354059-245354081 CTGAGGGTCTCCTCAGCCTGGGG + Intronic
1063087279 10:2831264-2831286 CAGCAGGGCTCCCCAACCTCCGG - Intergenic
1063689918 10:8277116-8277138 AAGAGGGGCTCCCTAGCTTCTGG + Intergenic
1064310416 10:14207460-14207482 ACCAGGGGGTCCCCAGCCCCTGG - Intronic
1065390408 10:25176079-25176101 CCGAGTGGTTCCACGGCCTCCGG + Exonic
1069797535 10:71062905-71062927 TGGAGGGGCTCCCCGGACTCTGG - Intergenic
1070599128 10:77853596-77853618 CCCAGGGCATCACCAGCCTCAGG + Intronic
1071498519 10:86187579-86187601 TCCTGGGGCTCCCCAGCCTCTGG - Intronic
1071812662 10:89200285-89200307 CTGTGGGGCACCACAGCCTCTGG + Intergenic
1072801508 10:98395368-98395390 GTGAGTGGTTCCCCAGCCTCAGG - Intronic
1073444879 10:103574673-103574695 CAGACGGGCTTCCCACCCTCAGG + Intronic
1073446192 10:103582051-103582073 CTGAGGGTCTGCCCAGCCCCAGG + Intronic
1073470786 10:103720899-103720921 CTGAGGGGCTCCCCCTCCCCGGG - Intronic
1075410000 10:122220491-122220513 CCCAGGGTCCCCCCAGCATCTGG + Intronic
1076404893 10:130205133-130205155 CTGAGGGGCTCCACAGGCCCTGG - Intergenic
1077122691 11:917591-917613 CCGAGGGGCTCCCTGGCCAGGGG - Intergenic
1077222010 11:1422017-1422039 CCGTGGGGCACCCCAACCTCAGG - Intronic
1078358714 11:10652059-10652081 CCGGGGGGCTCCTCGTCCTCGGG + Exonic
1082023216 11:47552492-47552514 ACGAGGGGCTCTCGAGGCTCGGG + Intronic
1082989664 11:59196561-59196583 CCCAGGGGTTCCCAACCCTCAGG + Intronic
1083363070 11:62124582-62124604 ACAAGGGGCGGCCCAGCCTCCGG - Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084363960 11:68685727-68685749 CAGAGGGTCTGCCCAGCCGCAGG - Intronic
1084546930 11:69819280-69819302 CCGCGGGGCTCCCCACCCGCCGG - Intergenic
1084643970 11:70443668-70443690 CCAAGGAGCACCACAGCCTCTGG + Intergenic
1084688676 11:70712128-70712150 CCGAGGAACACCGCAGCCTCTGG - Intronic
1085086603 11:73672026-73672048 CCCAGGGCCTGCACAGCCTCAGG - Intergenic
1088497565 11:110446766-110446788 ACGAGGGGCTGGCCAGCCACTGG + Intronic
1089456940 11:118631270-118631292 CTGGGAAGCTCCCCAGCCTCAGG - Exonic
1089996824 11:122916016-122916038 CCGAGACCCTTCCCAGCCTCTGG - Intronic
1090086273 11:123653943-123653965 CCCAGGGCCTCCCCAGGCACCGG - Exonic
1090233720 11:125129814-125129836 CAGAGGGGCGCCCCCGCCACCGG + Intergenic
1202815590 11_KI270721v1_random:45227-45249 CCGAGGGGCTCCCCATTGGCCGG - Intergenic
1092174126 12:6391172-6391194 CCCTGGGGCTGCTCAGCCTCAGG + Exonic
1093406113 12:18806765-18806787 CTGAGGTGGTCTCCAGCCTCTGG - Intergenic
1094703911 12:32896749-32896771 CCGAGCTGCTCGCCTGCCTCTGG + Exonic
1095986716 12:48004291-48004313 CCTCGGGGCTCCCCAGACGCTGG - Exonic
1097555290 12:61128483-61128505 CAGAGAGGCTCCCCAGCGTGGGG - Intergenic
1100395956 12:94186670-94186692 CCCGGGAGCTCCCCAGTCTCGGG + Intronic
1100529848 12:95453088-95453110 CCGATTGGTTCCCCATCCTCTGG + Intergenic
1100764248 12:97846039-97846061 CAGAGGGGGTCCCCAGTCTTGGG - Intergenic
1102575392 12:113853138-113853160 CCCAGGCCCTCCCCAGCCTGGGG - Intronic
1103140129 12:118541039-118541061 CCGAGGGACTGCTGAGCCTCCGG - Intergenic
1104890864 12:132139469-132139491 CCCAGGGGCTCCCCGCCCTTGGG + Intronic
1104958166 12:132475879-132475901 GCGACGGGTGCCCCAGCCTCCGG - Intergenic
1106224225 13:27773100-27773122 CTGAGGGGCTGCCAAGCCTTTGG - Intergenic
1107841240 13:44459642-44459664 CCTAGGGGCTCCCCAACCCAGGG + Intronic
1108408049 13:50124435-50124457 CCCAGCTGCTCCCCAGCCCCTGG - Intronic
1109100678 13:58180705-58180727 CCCAGGGGCTCTTCAGCCTGTGG + Intergenic
1113201223 13:107868331-107868353 CCGAGGACCTCCGCAGCCGCGGG + Intergenic
1113582377 13:111438407-111438429 CCCAGGGGCTCCCCGGTGTCCGG + Intergenic
1113927359 13:113949165-113949187 CGTGGGGGCTCCCCAGCCTGGGG - Intergenic
1114550333 14:23529138-23529160 CTGAGGGGATTCCCAGCCTCTGG - Intronic
1115640750 14:35334323-35334345 CCAAGGGGCGCCCCGGGCTCAGG + Intergenic
1118364644 14:65084053-65084075 GCCAGGGCCTCCCCAGCCACAGG + Intronic
1118616976 14:67580656-67580678 CCATGGGGCTGCCTAGCCTCTGG + Intronic
1118751785 14:68813109-68813131 CAGAGGAGCTGCCCAGGCTCTGG + Intergenic
1119808485 14:77498170-77498192 CAGTGGGGCTCTCCAGCCGCCGG - Intronic
1121437082 14:93927289-93927311 CTGAGGGGCCCCCCAGCTCCGGG + Intronic
1122266813 14:100550493-100550515 CCCAGGGGCTGCGCAGCCTGTGG + Intronic
1122904328 14:104795127-104795149 CCGTGGGGCTCCCCGGGCGCTGG - Intronic
1123106890 14:105845954-105845976 CAGAGGGGCACCAAAGCCTCTGG - Intergenic
1123171563 14:106377665-106377687 GTAAGGGGCTCCCCAGTCTCAGG - Intergenic
1123223130 14:106874949-106874971 GTAAGGGGCTCCCCAGTCTCAGG - Intergenic
1123694479 15:22868095-22868117 CCGAGGGCCTCCCCTGCCAATGG + Exonic
1124250981 15:28106544-28106566 CCAAGGGTCTCTCCACCCTCCGG + Intergenic
1125912718 15:43455928-43455950 CAGAGGGCTTCCCCAGCTTCTGG + Exonic
1126159502 15:45596907-45596929 CTCAGGTGATCCCCAGCCTCAGG + Intronic
1130894610 15:88160332-88160354 CTCAAGGGCTCCCCATCCTCAGG - Intronic
1130952848 15:88605818-88605840 CCGGGGCGCTGTCCAGCCTCTGG - Intergenic
1131164255 15:90130820-90130842 GCCAGGGGCTCCCCAGCCTTTGG + Intergenic
1132222704 15:100116920-100116942 CCAAGGGTCTGCCCAGCTTCCGG - Exonic
1132483538 16:178174-178196 GGGACAGGCTCCCCAGCCTCAGG - Intergenic
1132499730 16:280136-280158 CCGGGGGCCTGCCCAGCCTTGGG - Intronic
1132546072 16:534082-534104 CCGAGAGGCCCCCCAGCCGTGGG - Intronic
1132657907 16:1048937-1048959 CCCCGGGGCTCAGCAGCCTCAGG + Intergenic
1132809759 16:1791899-1791921 TCGAGGGCCTCGGCAGCCTCTGG - Exonic
1133379854 16:5320902-5320924 CCCAGGGGCGGCCCTGCCTCTGG + Intergenic
1134900616 16:17934605-17934627 CAGAGGGTCTACTCAGCCTCAGG + Intergenic
1135647787 16:24178394-24178416 CAGAGGTGCCCTCCAGCCTCAGG + Intronic
1136226558 16:28864048-28864070 CCGAGTGCCTCTCCAGCCCCCGG - Intronic
1136592032 16:31223350-31223372 CCTTGGGCCTCCCCAGCCACAGG - Intronic
1136719671 16:32310220-32310242 CACAGGCGCTCCTCAGCCTCAGG + Intergenic
1136838045 16:33516500-33516522 CACAGGCGCTCCTCAGCCTCAGG + Intergenic
1138473455 16:57256820-57256842 ACGCAGGGCTCCCCAGCTTCAGG + Exonic
1138883832 16:61050575-61050597 CCGAGGGGCTCCCAGACCTCTGG + Intergenic
1139529738 16:67537371-67537393 CCGAGGGGAACCCCAGTCACCGG + Intronic
1140047681 16:71453457-71453479 CCCAGGAGGTCCCAAGCCTCAGG + Intronic
1141199023 16:81882978-81883000 TGGAGGGGCTCCTCAGACTCTGG + Intronic
1141895657 16:86957271-86957293 CCGATGGGACCCCCACCCTCTGG - Intergenic
1142408834 16:89905998-89906020 CCCAGAGGCTCCCCAGCCGCAGG + Intronic
1203006760 16_KI270728v1_random:207549-207571 CACAGGCGCTCCTCAGCCTCAGG - Intergenic
1142604031 17:1071864-1071886 TGGAGAGACTCCCCAGCCTCAGG + Intronic
1143056542 17:4166750-4166772 CCAAGGGCATCTCCAGCCTCAGG - Exonic
1144672870 17:17142773-17142795 CTGAGGTGCTGCCCAGCCCCAGG - Intronic
1147044321 17:37742472-37742494 ACAGGGGGCTCCCAAGCCTCGGG - Intronic
1147550642 17:41439135-41439157 CAGGGGAGCTCCCCAGCCCCGGG - Intronic
1147757959 17:42780787-42780809 CCGCGGGGCAGCCCCGCCTCGGG + Exonic
1148054599 17:44786689-44786711 CCCAGGGGCAGCCCAGCCTGAGG + Intergenic
1148211429 17:45811028-45811050 GGGAAGGGCTTCCCAGCCTCAGG + Intronic
1148818976 17:50349327-50349349 CCTAGGGATTCCCCAGCCTGTGG + Intronic
1149536352 17:57436595-57436617 CCCAGGGGCTCCTCTGCCCCAGG - Intronic
1149597769 17:57874333-57874355 CTGAGGGGCTCCCCAGCACCTGG - Intronic
1149647209 17:58249384-58249406 GCGCGGGGCTCCCCCGCCCCGGG - Intronic
1150130401 17:62666029-62666051 TCGAGGGGCTTGGCAGCCTCTGG + Intronic
1150462100 17:65361668-65361690 CCCGGGGCCTCCCCAGCATCTGG - Intergenic
1151545161 17:74788400-74788422 ACAAAGGGCCCCCCAGCCTCTGG - Intronic
1151828577 17:76537156-76537178 CCGAGGTGCTCTCCTGCATCTGG + Intronic
1151930675 17:77229793-77229815 CTGAGGAGCACCCCATCCTCTGG - Intergenic
1152332484 17:79681162-79681184 CAGAGGGGTGCACCAGCCTCTGG + Intergenic
1152358185 17:79816557-79816579 CAGAAGGGCTCCCCTGCCTATGG - Intergenic
1152942264 17:83178851-83178873 CCGGGGGGCCCCCAGGCCTCAGG + Intergenic
1158799338 18:60888091-60888113 CCTAAGGCCTCCCCAGCCTTAGG - Intergenic
1160176995 18:76602837-76602859 CCGAGGGAGACACCAGCCTCCGG + Intergenic
1160222654 18:76988653-76988675 CCGAGGGGGGCCGCAGGCTCAGG + Intronic
1160752044 19:738929-738951 CCCAGGTGCGGCCCAGCCTCAGG - Intronic
1160837597 19:1132054-1132076 CCGAGGGCCTCGCCCGCCCCGGG + Intronic
1160862582 19:1244040-1244062 CCAAAGGGCTGCACAGCCTCAGG - Intronic
1160917379 19:1503683-1503705 CCCAGGGGCTCCCCAGCCAAGGG - Intergenic
1160974271 19:1784998-1785020 CCAAGGCGCTCCCTAGCCTGGGG - Intronic
1161589875 19:5124501-5124523 TCTAGGGGCTGGCCAGCCTCTGG + Intronic
1162401441 19:10449075-10449097 CCCAGGTGCTGGCCAGCCTCCGG + Exonic
1162793692 19:13075913-13075935 CAGAGGGGGTGCCAAGCCTCTGG + Intronic
1162822000 19:13228873-13228895 GCCAGGGACACCCCAGCCTCGGG - Intronic
1163331150 19:16638775-16638797 CTGAGTGGCTGCCCAGCATCAGG + Intronic
1163417299 19:17194468-17194490 CCGATGGGACCCCCAGCCTGCGG - Intronic
1163438984 19:17312121-17312143 ACGAGGGACTTCCCAGCCTCTGG - Intronic
1163460852 19:17436642-17436664 CCAAAGGGGTCCCCAGGCTCTGG + Exonic
1164535508 19:29083995-29084017 CAAAGGGGCTATCCAGCCTCTGG + Intergenic
1165443759 19:35845578-35845600 CCTAGTGCCTCTCCAGCCTCTGG - Intronic
1166010128 19:39935449-39935471 GCTAGGGACTCCCCAGCCTGTGG - Intergenic
1166038944 19:40191047-40191069 CCGAGGGGCCGTCCTGCCTCAGG + Intergenic
1166102078 19:40576922-40576944 CCGAGGGGGTCCCCAGTCGGGGG + Exonic
1166728238 19:45041864-45041886 CCCAAGCGCTCCCCAGCCACAGG + Intronic
1168640171 19:58025876-58025898 CCCACCTGCTCCCCAGCCTCAGG - Intergenic
1168646060 19:58059874-58059896 CCGCGGAGCTCCCCAGGCTCTGG + Intronic
925223198 2:2159506-2159528 GCGAGGTGCTCCCCAGCGTCTGG - Intronic
925370819 2:3344142-3344164 CCGAGGGAATCTCCTGCCTCTGG - Intronic
925725345 2:6865860-6865882 CGGAAGGGCGCCCCAGCCCCAGG - Intronic
925878066 2:8328761-8328783 CCTTGGGCCTCCCCAGGCTCTGG - Intergenic
928181287 2:29070792-29070814 CCGAGAGGGCCCCCAGCCTCTGG + Exonic
929455134 2:42059937-42059959 ACGAGGGGTTCACCAGCCCCTGG + Intergenic
931355767 2:61537237-61537259 GGGAGGGGTTCCCCAGCCCCTGG - Intronic
937001148 2:118468636-118468658 CTCAGAGGCTCCCCAGCTTCTGG - Intergenic
937310879 2:120902660-120902682 GCGAGGGGCAGCACAGCCTCTGG - Intronic
937408663 2:121653583-121653605 CAGTGGGGCTCCTCTGCCTCTGG - Intergenic
939638441 2:144610972-144610994 ATGTGGGGCTGCCCAGCCTCTGG + Intergenic
939957134 2:148536564-148536586 CCCAGGAGATCCCTAGCCTCTGG - Intergenic
942616654 2:177798008-177798030 CCGGGTAGCTCTCCAGCCTCAGG + Intronic
946420273 2:219560878-219560900 CCGGGTGGCTGCCCAGCCCCGGG + Intronic
946433450 2:219637684-219637706 CCGAGGGCCCCCCCAGCCCGAGG + Exonic
946747606 2:222861333-222861355 CCGAGGGGCTCCCCAGCCTCGGG + Intronic
947104035 2:226649799-226649821 GCTGGGGGCTCCCCAGCCTCTGG - Intergenic
947807887 2:232981132-232981154 CCGAGGGCCTCCCAAGCACCTGG + Intronic
948118231 2:235509769-235509791 AAAAGGGGGTCCCCAGCCTCTGG + Intronic
948700065 2:239753766-239753788 CCGGGCTCCTCCCCAGCCTCTGG + Intergenic
948732856 2:239978112-239978134 CCAAGAGGCCCCCCTGCCTCTGG + Intronic
948786095 2:240353690-240353712 CCCAGGAGCCCCTCAGCCTCTGG - Intergenic
1169198040 20:3693784-3693806 CCAAGGGGCTCCCCAGCAGTAGG - Intronic
1171212586 20:23328137-23328159 CCGAAGGTCTCCCCAGCAGCCGG + Intergenic
1172005793 20:31818616-31818638 CCGAGGGGCACTCTAGCCTGAGG - Intergenic
1172823482 20:37759561-37759583 CCTAGTGGCTCCCCAGACTGAGG - Intronic
1172880990 20:38199876-38199898 CCCTGGTGCACCCCAGCCTCTGG - Intergenic
1173203170 20:40969060-40969082 CCAGGGGGTCCCCCAGCCTCAGG + Intergenic
1173251429 20:41366090-41366112 ACGCGGGGCTCCCCCGCCCCGGG - Intronic
1173569804 20:44068769-44068791 CCGATGGGCCACCCTGCCTCTGG - Exonic
1176059583 20:63166626-63166648 CCCAAGGGCTCCCCAGCTTATGG + Intergenic
1176219357 20:63962732-63962754 CCCAGCGGGTCCTCAGCCTCAGG + Exonic
1178210304 21:30523535-30523557 CCTAGGGCCTCCCCAGCCCTGGG - Intergenic
1179790710 21:43754557-43754579 CTGAGGTGGTCCCCAGCCCCTGG + Intronic
1179983370 21:44907787-44907809 CTGCGGGACTCACCAGCCTCTGG - Intronic
1180183868 21:46130000-46130022 CAGCGAGGCTCACCAGCCTCTGG - Intronic
1181093129 22:20487858-20487880 CCCATAGGCTCCACAGCCTCTGG + Intronic
1184158204 22:42682761-42682783 AGGAGAGGCTGCCCAGCCTCAGG - Intergenic
1184426598 22:44412374-44412396 CCCAGGGCCTCCCCAGCCTCTGG + Intergenic
1184629160 22:45762649-45762671 CCAAGGGGCTTCCAGGCCTCAGG + Intronic
1185047962 22:48538351-48538373 CCATGGGGCGCCCCATCCTCAGG + Intronic
1185211698 22:49574219-49574241 CCGAGACGCTCCCCAGACGCCGG + Intronic
1185251726 22:49805532-49805554 CCGATGCCCTCTCCAGCCTCTGG - Intronic
1185412796 22:50694826-50694848 CCGAGGGGATGCCAAGCCACTGG - Intergenic
949434463 3:4013329-4013351 CCCAAGGGGTCCCCAGCCCCTGG - Intronic
950366045 3:12484812-12484834 CCGAGAGGAGCCGCAGCCTCTGG + Exonic
950744189 3:15073933-15073955 TCTATGGGCTCCTCAGCCTCTGG + Exonic
952884539 3:38004198-38004220 CAGAGGGGCACCCCAGCCCATGG - Intronic
952939505 3:38431726-38431748 CCTAAGGCCTCCCCAGCCTTAGG - Intergenic
961252667 3:125520096-125520118 CCGCTGGGCTCCCCAGACGCTGG - Exonic
961424497 3:126834513-126834535 CCTAGGAGCTCCCCTGCTTCTGG - Intronic
961514274 3:127423038-127423060 CCCAGGCGCCCCCCAGCCTTGGG - Intergenic
962343300 3:134602642-134602664 CCAAGGGCCTGGCCAGCCTCTGG + Intronic
965115118 3:164478285-164478307 CCTAGGGGCTCCCCAAGCTTGGG + Intergenic
965539471 3:169857953-169857975 CTGAGGTGTTCCCCAGGCTCAGG + Intronic
966851006 3:184164989-184165011 CCCAGGGGCCCCGCATCCTCAGG - Intronic
967760332 3:193217168-193217190 ACCAGGGGCTCTCCAGCCTTTGG - Intergenic
967811142 3:193762107-193762129 CTGAGGGCCTCCCCTCCCTCTGG - Intergenic
967878032 3:194280041-194280063 TCGAGGGGCTCCCAGGCCACTGG + Intergenic
967914128 3:194565478-194565500 CCCAGGTGATCCCCTGCCTCGGG - Intergenic
968547311 4:1205802-1205824 CCGAGGGCCTGCACAGCTTCAGG - Intronic
968618334 4:1592477-1592499 CCGCAGCGCCCCCCAGCCTCCGG - Intergenic
968706475 4:2080634-2080656 CTGAGGGGTTCGCCTGCCTCTGG + Intronic
972690266 4:41390285-41390307 CAGAGAGGCTCCCCAGCATGAGG - Intronic
973613964 4:52660710-52660732 ACTCGGGGCTGCCCAGCCTCAGG - Intergenic
981993727 4:150954180-150954202 CAGAGGGGCCCCCCACCTTCTGG - Intronic
984581423 4:181514803-181514825 CCGAGTGGCTACCACGCCTCAGG - Intergenic
985610936 5:888159-888181 GGGAGGGGCTCCACAGCCTCGGG - Intronic
985699329 5:1361093-1361115 CCCTAGGGCTCCCCAGCTTCTGG - Intergenic
985795594 5:1959532-1959554 CCGAGGGCATCCCCAGTCCCAGG + Intergenic
987061958 5:14251568-14251590 CAAAGAGGCTGCCCAGCCTCTGG - Intronic
989202720 5:38781159-38781181 CCGCAGGGCTTCCCTGCCTCTGG - Intergenic
990048606 5:51466908-51466930 CCCAGGTGCTCAGCAGCCTCTGG + Intergenic
990418497 5:55609155-55609177 CTGAGGGGCTTTCCAGCTTCAGG - Intergenic
992431662 5:76716259-76716281 CCGGGAGGCTGCCCCGCCTCGGG - Exonic
995449197 5:112281530-112281552 CCCTGGGGGTCCCCAGCATCTGG - Intronic
997207391 5:132057717-132057739 CCCAGGGGGTGCTCAGCCTCTGG + Intergenic
997233319 5:132258689-132258711 CCTTGGGGGTCCCCAGCCTAAGG + Intronic
1000223158 5:159233690-159233712 CCAAGGGGCTCTCGAGCCTTTGG - Intergenic
1001515526 5:172352958-172352980 AAGAGGGGCTCCTCAGCCTGGGG - Intronic
1001993324 5:176134636-176134658 CCCGGGGGCACCCCAGGCTCAGG - Intergenic
1002260760 5:177992670-177992692 CCAAGGTGATCCCCAGCCTGCGG - Exonic
1005029155 6:21493231-21493253 CAGAGGTGCTGCCCAGACTCTGG + Intergenic
1005849862 6:29813311-29813333 GCAAGGGGGTCCCCAGCATCAGG - Intergenic
1012441201 6:99263912-99263934 TCGACTGGCTCCCCATCCTCTGG + Intergenic
1013099686 6:106975572-106975594 GCGAGCGGCTCCCCAGCTCCTGG - Intronic
1016224234 6:141715312-141715334 GCGAGGGGCTCCCGAGCCTTTGG - Intergenic
1018862708 6:167722749-167722771 GCCACGGGCTCCCCAGACTCTGG + Intergenic
1019412568 7:912632-912654 CAGAGGGGCTTCCCTGCCACAGG + Intronic
1019635765 7:2074829-2074851 CCGAGGGCCCCCCCAGCCTCCGG - Intronic
1019901195 7:4021954-4021976 CCTGAGGGCTCCTCAGCCTCAGG + Intronic
1020441429 7:8221149-8221171 CAGAGCAGCTCCTCAGCCTCAGG + Intronic
1021830497 7:24602985-24603007 CCACATGGCTCCCCAGCCTCAGG - Intronic
1025878361 7:65509062-65509084 CCGAGGGGCTCTCCCGGCTCGGG - Intergenic
1026841079 7:73670178-73670200 AGGAGGGGCTCCCCAGCCTGAGG - Intronic
1030069344 7:105685594-105685616 CAGAGGGGCCCCTCAGCCTGTGG + Intronic
1033542807 7:142372699-142372721 CTGAGATGCTCCCCTGCCTCTGG + Intergenic
1033732776 7:144195481-144195503 CCGCCGGGCTCCACAGCCGCCGG + Intronic
1033743627 7:144294061-144294083 CCGCCGGGCTCCACAGCCGCCGG + Intergenic
1033750275 7:144355536-144355558 CCGCCGGGCTCCACAGCCGCCGG - Intronic
1034240854 7:149609685-149609707 ACGATGGGCTCCCCATTCTCAGG + Intergenic
1034245821 7:149643585-149643607 ACGATGGGCTCCCCATTCTCCGG + Intergenic
1034265812 7:149780166-149780188 CTGAGGGGCTCCCCACCCTGTGG + Intergenic
1034807782 7:154103863-154103885 GCCGGGGGCTCTCCAGCCTCTGG + Intronic
1035157574 7:156926476-156926498 CCTTGGGTCTCCACAGCCTCTGG + Intergenic
1035171975 7:157021897-157021919 CTGAGGGGCTCCCAAGACCCCGG - Intergenic
1036634350 8:10538689-10538711 CCTATGGGCTCCCCAGTCTCGGG + Exonic
1041143299 8:54845115-54845137 CCCAGGGGCCACCCAGCTTCTGG - Intergenic
1044932109 8:97260504-97260526 CAGAGGGGGTGCCCAGCCTTGGG - Intergenic
1046820634 8:118630549-118630571 CCCATGGGCTCTCCAGCCTTTGG + Intergenic
1048989169 8:139751291-139751313 CCCTGGGCATCCCCAGCCTCTGG - Intronic
1049765456 8:144353323-144353345 CTGAGGGCCTCCCCCACCTCGGG - Exonic
1049793429 8:144484088-144484110 CCGTGAGGGTCCCCAGCCTTAGG - Intronic
1049820930 8:144632736-144632758 CCGAGTCCCTGCCCAGCCTCAGG - Intergenic
1050620056 9:7442730-7442752 ACCAGGGGCTCTCCAGCCTTTGG - Intergenic
1053153433 9:35757107-35757129 CCGGGCGGCGCTCCAGCCTCGGG + Exonic
1055187613 9:73474818-73474840 CCGAGTCCCTCGCCAGCCTCTGG + Intergenic
1058096195 9:100862864-100862886 GCCAGGGGCTCTCCAGCCTTTGG + Intergenic
1061184042 9:129041760-129041782 CTGAGGGGCTCCCAGGCCTGGGG + Intronic
1061458018 9:130713115-130713137 CGGAGGGGCTCCTCAGCCGCAGG - Intergenic
1061486997 9:130925050-130925072 CCTGTGGCCTCCCCAGCCTCAGG - Intronic
1061578946 9:131525021-131525043 CTGAGGGGCTGCCGAGCCTCAGG - Exonic
1061930720 9:133831791-133831813 GCCAGGAGCTCCCCAGGCTCTGG + Intronic
1061943960 9:133898118-133898140 CCGAGGTCCCTCCCAGCCTCAGG - Intronic
1061992200 9:134165363-134165385 CCGAGGGTCTGCACAGCCTGGGG + Intergenic
1062038052 9:134391473-134391495 GCGAGGGGGCCCCCAGCCTGTGG - Intronic
1062106500 9:134757826-134757848 CCGAGGGGCTGCCCGCGCTCAGG - Intronic
1062281477 9:135753850-135753872 CCGAGGGCTTCCACAGGCTCGGG - Intronic
1062381996 9:136291049-136291071 CAGGGGGGCTCCCAGGCCTCTGG + Exonic
1062565647 9:137162839-137162861 CCGAGGGGTTCCTCAGCTGCAGG - Exonic
1062718560 9:138023249-138023271 TCGGGGGCCTCCGCAGCCTCAGG - Exonic
1187277869 X:17832235-17832257 CTGAGGGGCTTCCCAGGCCCTGG + Intronic
1189007565 X:37010627-37010649 CCCAGAGCCTCCCAAGCCTCGGG + Exonic
1193318604 X:80094179-80094201 CCAAGGGGCTACCCAGAATCTGG - Intergenic
1201895951 Y:18993021-18993043 GCGAGCGGCTCCCCAGCTCCTGG - Intergenic