ID: 946748200

View in Genome Browser
Species Human (GRCh38)
Location 2:222866569-222866591
Sequence CAGGTTAAGAACAGGGACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 7, 3: 49, 4: 351}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946748200_946748206 -2 Left 946748200 2:222866569-222866591 CCAGAGTCCCTGTTCTTAACCTG 0: 1
1: 0
2: 7
3: 49
4: 351
Right 946748206 2:222866590-222866612 TGGGCGCTGCATCTCCTCTCTGG 0: 1
1: 0
2: 0
3: 16
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946748200 Original CRISPR CAGGTTAAGAACAGGGACTC TGG (reversed) Intronic
902835214 1:19043032-19043054 GGGGTTCAGCACAGGGACTCTGG - Intergenic
903002987 1:20279604-20279626 CAGGTTAAGGACAGGGAAGTAGG + Intergenic
903496412 1:23770794-23770816 GTGGTTAAGAACATGGACTCAGG + Intergenic
904320454 1:29694788-29694810 CTGGTTAAGAGCTAGGACTCTGG + Intergenic
905144957 1:35881138-35881160 GAGGTGAAGAACAAAGACTCTGG - Intronic
905476762 1:38234271-38234293 CAGGATCAAAACAGGGATTCTGG - Intergenic
905900368 1:41577443-41577465 GTGATTAAGAACAAGGACTCAGG - Intronic
906617315 1:47242250-47242272 CAGGTTAAGAGCATGGGATCTGG + Intergenic
907229193 1:52979540-52979562 CATGTTAAGAACATGGACTTTGG + Intronic
907408518 1:54268761-54268783 CAGGGGAAGAACCAGGACTCTGG + Intronic
907574795 1:55516633-55516655 CACCTTAGGAACATGGACTCTGG - Intergenic
907733698 1:57091620-57091642 GAGGTTAAGAACATGGACACTGG + Intronic
909265756 1:73556294-73556316 CAAGTTAAAAACATGGACTCTGG - Intergenic
909663811 1:78111874-78111896 GTGGTTAAGAACATGGACTTTGG - Intronic
911187781 1:94920690-94920712 GTGGTTAAGAACATGGACTGTGG - Intronic
911360058 1:96864822-96864844 CAGGTTAAGAGCACAGGCTCTGG + Intergenic
911526939 1:98999433-98999455 CAGGTTAAGATCACAGACTCTGG - Intronic
911527865 1:99006931-99006953 CAGCATAAGAGCAGTGACTCTGG + Intergenic
912252428 1:108025489-108025511 GAGGTTAAGGACATAGACTCTGG + Intergenic
912379930 1:109241862-109241884 TAGCTCAAGAACAAGGACTCAGG - Intergenic
912745909 1:112245052-112245074 ATGGTTAAGAACACAGACTCTGG + Intergenic
916201248 1:162273463-162273485 CAGGTCAAGAACAGAGGCTTCGG - Intronic
918607710 1:186448900-186448922 CAGATTAAGAAAACAGACTCTGG + Intronic
918691864 1:187490816-187490838 GTGGTTAAGAACATGGACTTTGG - Intergenic
919326601 1:196115339-196115361 TAGATAAAGAACAGGGGCTCTGG - Intergenic
919794010 1:201310404-201310426 AAGGTCAAGAACACAGACTCTGG - Intronic
920061093 1:203227468-203227490 GTGGTTAACAGCAGGGACTCTGG + Intronic
920212928 1:204341425-204341447 CAGATAAAGAACTGGGAGTCTGG + Intronic
920447365 1:206028815-206028837 AAGGTTAAGAGCAGGAACACTGG + Intergenic
921066278 1:211624569-211624591 GAGGTTAAAAACATGGACTCTGG + Intergenic
921545051 1:216464695-216464717 CTGGTTATGAACATGGACCCTGG + Intergenic
924402577 1:243702330-243702352 ATGGTTAAGAGCAAGGACTCTGG + Intronic
1063381050 10:5586266-5586288 TGGGTTAAGACCATGGACTCTGG - Intergenic
1064140969 10:12790032-12790054 CAGGCCAGGAACAGGGAGTCAGG + Intronic
1064292572 10:14049359-14049381 CAGGTTGAGAACAGGAAGTCAGG + Intronic
1064427843 10:15245688-15245710 GTGGTTAAGAGCAGGGAGTCTGG - Intronic
1064918603 10:20490186-20490208 AAGGTTAAGAATATGGGCTCTGG - Intergenic
1064929120 10:20604100-20604122 CAGTTGAGGAACTGGGACTCTGG - Intergenic
1065405911 10:25364217-25364239 GTGGTTAAGAACATGGACTTTGG - Intronic
1065429042 10:25634870-25634892 CAGTTTAAGGCCAGGGACTCAGG - Intergenic
1065608832 10:27449765-27449787 CTGGTTAAAAACATGGACTCGGG + Intergenic
1066995832 10:42562191-42562213 CTGGCTAAGACCAGGGACTAGGG - Intergenic
1067833456 10:49623410-49623432 AAGGTTCAAAACAGGCACTCAGG - Intronic
1069225005 10:65932095-65932117 GGGGTTAAGAATAGGGACTCTGG + Intronic
1070276763 10:75014713-75014735 CTGGTTAACAGCATGGACTCCGG - Intronic
1070516010 10:77207324-77207346 GAGGTTAAGAAAATGGACTCTGG + Intronic
1071688511 10:87789491-87789513 CAGGTGAAGAACTTGAACTCAGG + Intronic
1074259193 10:111834780-111834802 CTGGTTAAGAGCACAGACTCCGG - Intergenic
1074765951 10:116700201-116700223 ATGTTTAAGAACACGGACTCTGG - Intronic
1075158607 10:120002676-120002698 CAAGTTAAGATCACAGACTCTGG + Intergenic
1075774363 10:124970563-124970585 CAGTTTCAGAATAGGGAGTCAGG + Intronic
1078307091 11:10200126-10200148 AGGGTTAAGAATATGGACTCAGG + Intronic
1078520191 11:12056816-12056838 CTGATTAAGAGCATGGACTCTGG - Intergenic
1078927163 11:15885424-15885446 CCGGTTAAGAACATGGACCCAGG - Intergenic
1078972030 11:16425257-16425279 GTGGTTAAGAACATGGACTCTGG + Intronic
1079247418 11:18762864-18762886 CTAGTCAAGAACAGGGACTCTGG - Intronic
1079339534 11:19600554-19600576 GTGGCTAAGAACATGGACTCTGG + Intronic
1079747851 11:24155658-24155680 CTGGTGAAGAACAGGGGGTCTGG - Intergenic
1079779533 11:24583422-24583444 TTGGTTAAGAGCAGGGACACTGG + Intronic
1080848098 11:36044081-36044103 ATGGTTAAGAACAGGGGCTTTGG + Intronic
1081561384 11:44220356-44220378 CAGGCTAAGGAAAGGTACTCGGG - Intronic
1081703976 11:45169778-45169800 GTGGTTAAGAGCATGGACTCTGG - Intronic
1081947015 11:47005648-47005670 GTGGTTAAGAACATGGACTTTGG + Intronic
1082098793 11:48154232-48154254 GGGGTTAAGAACACAGACTCTGG - Intronic
1083161559 11:60857573-60857595 GTGGTTAAGCCCAGGGACTCTGG + Intergenic
1083419306 11:62544433-62544455 GAGGTTATGCACAGGGACACTGG - Intronic
1083485042 11:62977929-62977951 GAGGTTAAAAACATTGACTCAGG + Intronic
1084464881 11:69316733-69316755 GAGGTGAAGCACACGGACTCTGG + Intronic
1085498924 11:76999631-76999653 GAGGTTAAGGACAGGGAGTGAGG - Intronic
1085526762 11:77168492-77168514 CAGGTGAAGAACTGGGGCCCAGG + Intronic
1085758265 11:79219568-79219590 CAGGTGAAGAAAGGAGACTCTGG + Intronic
1085816932 11:79747482-79747504 CAACTTAAGAACAGGGAGCCAGG - Intergenic
1086556967 11:88121860-88121882 TGGGTTAAGAGCAGGGGCTCTGG - Intronic
1086670905 11:89546452-89546474 CAGGATAAGAGCTGGGACTCAGG + Intergenic
1087054292 11:93918434-93918456 GAGGTTCAGAGCATGGACTCTGG + Intergenic
1087914158 11:103789183-103789205 GTGGTTAAGTACAGAGACTCTGG + Intergenic
1087976124 11:104549519-104549541 GAGGTTAAGAACATGGGCTTTGG + Intergenic
1089533531 11:119147653-119147675 CAGGGTAAAATCAGGGACTTTGG + Intergenic
1092986281 12:13849190-13849212 CAGGACAAGAACTGGGACTCTGG + Intronic
1093011524 12:14112052-14112074 CAGCTTAAGAAAGGGGATTCTGG - Intergenic
1093203404 12:16217443-16217465 AAGGTTAAGAGCATGGGCTCTGG + Intronic
1094645841 12:32323536-32323558 CAGGTAAAGAACTGGGCCTGTGG - Intronic
1095700097 12:45182329-45182351 CAAGTTAAGAAAATAGACTCTGG - Intergenic
1095892586 12:47248696-47248718 GAGGTTAAGAACATGGGCTTGGG + Intergenic
1095974612 12:47930735-47930757 CAGGTGAAGTGCAGGGACCCAGG - Intronic
1096034723 12:48456512-48456534 GAGATTAAGATCATGGACTCTGG + Intergenic
1096230015 12:49891591-49891613 GTGGTTATGAGCAGGGACTCTGG - Intronic
1096567692 12:52495050-52495072 CTGGTTAAGAGCATGGACTTTGG + Intergenic
1097130335 12:56806619-56806641 CAGGTGCATATCAGGGACTCTGG + Intergenic
1097696457 12:62779719-62779741 GTGGTTAAGAGCAGGGACTCTGG - Intronic
1097818253 12:64099090-64099112 TAGGTTAAGAATAGAGGCTCTGG + Intronic
1097893197 12:64799185-64799207 TTGGTTGAGAACATGGACTCTGG + Intronic
1099310816 12:81019902-81019924 CAGGTTAACAACAGAAACTATGG + Intronic
1101511123 12:105393240-105393262 GAGGTTAAGAGCACAGACTCTGG + Intronic
1101912307 12:108869277-108869299 GTGATTAAGACCAGGGACTCTGG - Intronic
1101914960 12:108888862-108888884 GGGGTTAAGAACATGAACTCTGG + Intronic
1102856482 12:116298930-116298952 GAGATTAAGAGCTGGGACTCTGG + Intergenic
1103673466 12:122637460-122637482 ATGGATAAGAAAAGGGACTCAGG - Intergenic
1104633595 12:130424596-130424618 CCGGTGAAGCACAGGGGCTCGGG - Intronic
1104771837 12:131368714-131368736 CAGGGTCAGAGCAGGCACTCTGG + Intergenic
1105326256 13:19372925-19372947 CTGGTTAAGAACCTGGACGCTGG - Intergenic
1106594164 13:31122776-31122798 CAGGTTCTGAACATGGACTTGGG - Intergenic
1107351781 13:39522367-39522389 CTGGTTAGGAGCATGGACTCTGG - Intronic
1107726398 13:43304050-43304072 CAGGTGCAGAACATGGAGTCGGG - Intronic
1108583741 13:51849757-51849779 CAGGTTAAGGACAGGAAGACAGG - Intergenic
1108596877 13:51956840-51956862 AAGGTTAAGAAAATAGACTCTGG + Intronic
1108671826 13:52698076-52698098 CCGGTTGTGAACAGGGACTTAGG + Intronic
1110676838 13:78258186-78258208 CAGGACAAGAAGAGTGACTCCGG - Intergenic
1111184100 13:84708165-84708187 ATGGTTAACAGCAGGGACTCTGG - Intergenic
1112218439 13:97460813-97460835 GATGTTCAGCACAGGGACTCTGG + Intronic
1112225303 13:97533641-97533663 CAGGGAAAGAGCAGGGATTCTGG + Intergenic
1112529983 13:100191575-100191597 AAGGTTAAGAACAGGGACTGTGG - Intronic
1113442800 13:110342503-110342525 CAGGTTAAGAACATGGACCATGG + Intronic
1114676079 14:24441149-24441171 GTGGTTAAGAACAGGAACTTGGG + Exonic
1114804733 14:25821837-25821859 GAGGTTAAGAGCAAGGACTCTGG - Intergenic
1115499479 14:34036504-34036526 ATGGTTAGGAGCAGGGACTCTGG - Intronic
1116353576 14:43898320-43898342 GTGTTTAATAACAGGGACTCTGG + Intergenic
1117713107 14:58552786-58552808 CAGGTAAAGAACAGGCCCACTGG + Intergenic
1118170755 14:63386425-63386447 GAGGTTAAGAATAGAGACTTTGG - Intronic
1118324396 14:64771595-64771617 ATGGTTAAGAACGGGGACTCAGG - Intronic
1118452836 14:65919494-65919516 CAGTTTAAGAAAAGGGACTAGGG - Intergenic
1119139611 14:72254492-72254514 TAGGAGAAGAACAGGGACTGTGG - Intronic
1119159417 14:72440760-72440782 CAGGTTAAGAACAGAGTTTTAGG - Intronic
1120184751 14:81383171-81383193 GAGGTTAAGATCAGGGACCCTGG + Intronic
1120524975 14:85567418-85567440 CTGGTTAAGAGCATGGATTCTGG + Intronic
1120532240 14:85646120-85646142 GAGGTTAAGAAAATGAACTCAGG + Exonic
1120999196 14:90439296-90439318 CAGGTTAACAGTAGGTACTCAGG - Intergenic
1121223931 14:92307654-92307676 CAGTCTAAGAAGAGAGACTCTGG - Intergenic
1121613761 14:95299155-95299177 CGGGTAGAGAAAAGGGACTCGGG + Intronic
1122498841 14:102180371-102180393 GTGGTTAAGAGCAGAGACTCTGG - Intronic
1122695587 14:103550644-103550666 CAGGCTGAGAACTGGGCCTCTGG - Intergenic
1123943785 15:25229261-25229283 CAAGGTGAGAACAGGGGCTCTGG - Intergenic
1126577309 15:50209765-50209787 ATTATTAAGAACAGGGACTCTGG + Intronic
1127927192 15:63558225-63558247 AAGGTTAAGAGCACGGGCTCTGG + Intronic
1129108427 15:73323958-73323980 CAGAACAAGAACAGGCACTCAGG + Intronic
1130333816 15:82941980-82942002 CGGGTCAAGAACAGGGACCTTGG - Intronic
1130788608 15:87127405-87127427 CAGGATAAGGACATGGTCTCTGG - Intergenic
1131073180 15:89478594-89478616 AGGGTCAAGGACAGGGACTCTGG - Intronic
1131130857 15:89899384-89899406 GAGGATAAGAACAGGGCCCCAGG - Exonic
1131741420 15:95397151-95397173 ATGGTTAAGAACACAGACTCAGG - Intergenic
1131819123 15:96253975-96253997 TAGGTGAAGAATAGGGGCTCTGG - Intergenic
1133406984 16:5532434-5532456 CAGGTTCAGATCAGTGAGTCCGG - Intergenic
1134217910 16:12330661-12330683 CTGGTTAAGAACCAGGGCTCTGG - Intronic
1135205579 16:20480983-20481005 TGGTTTAAGAACAGGGACTGTGG + Intronic
1135213328 16:20542830-20542852 TGGTTTAAGAACAGGGACTGTGG - Intronic
1137884474 16:52087776-52087798 CAGGTTAAGATAAAGGACTGTGG - Intergenic
1137966485 16:52938909-52938931 CAGGTGAAGTACAGGAATTCTGG + Intergenic
1138220833 16:55249175-55249197 CAGATTAAGAACAGAGGCACAGG + Intergenic
1138379381 16:56589725-56589747 GAGGTGAAGAATAGGGAATCAGG - Intronic
1139325550 16:66150148-66150170 CAGTTTAAGATGGGGGACTCAGG - Intergenic
1139690318 16:68637511-68637533 AAGATTAAGAGCATGGACTCTGG - Intronic
1140222005 16:73050366-73050388 CAGATAAAGAAAAGGAACTCAGG - Intronic
1141195277 16:81855976-81855998 CAAATTAAGAACAGGGGGTCAGG - Intronic
1142732994 17:1875000-1875022 CTGGGAAAGAACAGGGAATCAGG - Intronic
1143045741 17:4077918-4077940 CAGCTGAAGAGCACGGACTCTGG - Exonic
1143729601 17:8873525-8873547 GTGGTTAAGCGCAGGGACTCTGG + Intergenic
1144584198 17:16478032-16478054 CAGGGTGAGAGCAGGGACGCTGG - Intronic
1146508512 17:33425951-33425973 AAGGTGAAGCGCAGGGACTCTGG + Intronic
1146741348 17:35286546-35286568 CAGGTTAATAATATGGACCCAGG + Intergenic
1147029733 17:37623027-37623049 GTGGTTAAGACCATGGACTCAGG - Intronic
1147255848 17:39181562-39181584 GAGGTTAAGAGGAGGGACTCTGG - Intronic
1148081937 17:44971616-44971638 CCTGCTAAGAACAAGGACTCAGG + Intergenic
1148263736 17:46207694-46207716 CAGGTTGAGCACAGGGGATCAGG + Intronic
1150532483 17:65998884-65998906 TGGGTTAAGAGCATGGACTCTGG - Intronic
1150747940 17:67831556-67831578 GATGTTAAGACCAGGAACTCTGG + Intronic
1151932093 17:77238919-77238941 CAGATCAGGAACTGGGACTCTGG + Intergenic
1153354747 18:4122812-4122834 AAGGCTAAGAATAGGAACTCAGG + Intronic
1154161905 18:11986726-11986748 AAAATTGAGAACAGGGACTCCGG - Intronic
1156488535 18:37482302-37482324 CAGGAAAAGAACAGGAAGTCAGG + Intronic
1159058512 18:63490675-63490697 CATGGGAAGAACAGGGTCTCTGG + Intronic
1160159401 18:76459824-76459846 CAGGCTAAGAACAGGCGATCCGG + Intronic
1161846579 19:6714560-6714582 GTGGTTAAGAACAGGGACCCAGG + Intronic
1161961804 19:7527501-7527523 CAGTCTAAGGACAGGGAGTCAGG - Exonic
1162484217 19:10948902-10948924 CTGATTAAGAACATGGATTCTGG - Intergenic
1162838362 19:13336867-13336889 GAGGTTAAGCCCATGGACTCTGG - Intronic
1162841008 19:13356438-13356460 GTGGTTAAGAGCAGAGACTCAGG - Intronic
1164637869 19:29804755-29804777 CAGGTGGAGATCAGGGCCTCAGG + Intergenic
1165133975 19:33653618-33653640 GTGGTTAAGAACACGGACTCTGG + Intronic
1165780801 19:38433328-38433350 GTGATTAAGAACAAGGACTCCGG - Intergenic
1165848171 19:38832482-38832504 CAGGCTAAGAACATGAACTCTGG - Intronic
1166831028 19:45639575-45639597 GTGGTTGAGAACATGGACTCGGG + Intronic
1167309806 19:48730460-48730482 CATGTTAAGAAATGGGTCTCTGG - Intronic
1167780394 19:51595066-51595088 CAGGTTTAGGACAGGGAATCTGG - Intergenic
1168337098 19:55602937-55602959 CAGGTTTAGAGCAGGGAGTTTGG + Exonic
1168459795 19:56544561-56544583 GAGGTTAAGAGCATGGACTGTGG + Intronic
925145950 2:1583449-1583471 CAGGCTTAGCACAGGGACTGGGG - Intergenic
925302820 2:2829058-2829080 CAGGTTCATCCCAGGGACTCTGG - Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
927743950 2:25598720-25598742 CAGGTTGAGGATAGGGACTGGGG + Intronic
929766404 2:44847556-44847578 ATGGTTAAGAGCATGGACTCTGG + Intergenic
930145495 2:47998764-47998786 ACGGTTAAGAACATGGACTCTGG - Intergenic
931155609 2:59625213-59625235 ATGGTTAAGAACATGGACCCTGG + Intergenic
932117848 2:69069266-69069288 CTGATTAAGAACAGGGCCTCTGG + Intronic
932229936 2:70074813-70074835 GAGGTTAAGAGCATGAACTCGGG + Intergenic
932796548 2:74700747-74700769 AAAGTTAAGAACATGGTCTCTGG - Intergenic
933066711 2:77807420-77807442 CAGGTTAAGATAAAGGACTGTGG - Intergenic
933943320 2:87263457-87263479 CATGACAAGAACAGGGATTCTGG - Intergenic
934952804 2:98590347-98590369 GAGGTTAAGAGCACGGACTTTGG + Exonic
935106229 2:100046346-100046368 TGGTTTAAGAACATGGACTCTGG - Intronic
936336894 2:111598104-111598126 CATGACAAGAACAGGGATTCTGG + Intergenic
937016666 2:118611969-118611991 GAGGTTAAGGACGGGGTCTCTGG + Intergenic
937236460 2:120434318-120434340 ATGGTTAAGAACAGGGCCTTTGG + Intergenic
937821216 2:126313223-126313245 CAGAATAAGAACAGGAACTCTGG + Intergenic
938664198 2:133517489-133517511 CAGCTTGAGAAAAGGGACTTTGG - Exonic
938927162 2:136054726-136054748 GGGGTTAATAACATGGACTCTGG - Intergenic
939400903 2:141692564-141692586 TAGGTTAAGAACAGGGGCAATGG - Intronic
939965208 2:148603873-148603895 TTTGTTAAGAACATGGACTCTGG + Intergenic
940158946 2:150691289-150691311 CAGGTGAGGAAAAGGGAGTCTGG - Intergenic
940571542 2:155442296-155442318 AACGTTAAGAACATGAACTCTGG - Intergenic
942408374 2:175680242-175680264 GATGTTAAGAGCATGGACTCTGG + Intergenic
942494783 2:176528479-176528501 TATGTTAAGAACAAGGGCTCTGG + Intergenic
942938861 2:181592676-181592698 TGGGTTAAGAACATGGACTGTGG + Intronic
943059023 2:183018358-183018380 CTGGTTAAGAGGATGGACTCTGG - Intronic
943238702 2:185356841-185356863 CAGGTTAGGAACCTGGACTGTGG - Intergenic
943597802 2:189878973-189878995 GTGGTTAAGAACAGGAGCTCTGG - Intergenic
944356543 2:198796018-198796040 CAGATTAGGAACAAGGAATCAGG - Intergenic
945207045 2:207343431-207343453 CAGATGAAGAACAGGGTCTGAGG - Intergenic
945817920 2:214628301-214628323 GTGGTTAAGAGCATGGACTCTGG - Intergenic
946748200 2:222866569-222866591 CAGGTTAAGAACAGGGACTCTGG - Intronic
946867084 2:224051430-224051452 AAGGTTAAGAACACAGACTTTGG + Intergenic
946960162 2:224976591-224976613 CAGGTGAACAACAGGTACCCAGG + Intronic
947171829 2:227320296-227320318 CAGGTTAAGATAAAGGACTGTGG + Intergenic
947545855 2:231009680-231009702 CAGGATGAAGACAGGGACTCCGG - Intronic
948308189 2:236965537-236965559 CAGGTCAAAAACACGGCCTCAGG - Intergenic
948452388 2:238084171-238084193 CAGGTAGAGAACCGGGACTTAGG + Intronic
1169394083 20:5214469-5214491 CCGGGTAAGACCAGGCACTCTGG + Intergenic
1171261083 20:23735183-23735205 CAGGATAAGAGAAGTGACTCAGG + Intergenic
1171385325 20:24765904-24765926 GAGGTTAGGACCAGGGACTGAGG + Intergenic
1172106299 20:32519116-32519138 CATGTTAAGAACAGGGCTCCAGG - Intronic
1173729397 20:45318000-45318022 CAGGGCAGGGACAGGGACTCAGG - Intergenic
1174136905 20:48386042-48386064 GTGGTTAAGAACATGGTCTCTGG + Intergenic
1174412469 20:50344819-50344841 CAGGTCAGGAACCAGGACTCTGG + Intergenic
1175502054 20:59457446-59457468 GAGGTTAGGAGCTGGGACTCTGG - Intergenic
1177447098 21:21211884-21211906 GAGGTAAAGAACTGGGAATCAGG - Intronic
1178518027 21:33265038-33265060 CAGTTTAAGGACTGGGACTCAGG + Intronic
1180902742 22:19386448-19386470 CTGCTCAAGAACAGGGACTGTGG + Intronic
1181408912 22:22704410-22704432 CAGGGTAAGACCAGGGGCTTAGG - Intergenic
1181690748 22:24558437-24558459 CTGGTTAAGAACTTGGACTTGGG + Intronic
1182087911 22:27574110-27574132 TGAGTTAAGACCAGGGACTCTGG + Intergenic
1182702031 22:32248142-32248164 CAGGTGAAGGGCAGGGACCCAGG + Intronic
1183076069 22:35427871-35427893 GTGGTTAAGAACATGGACTTGGG + Intergenic
1184783730 22:46661905-46661927 AAGATAAAGAACAGGCACTCAGG - Intronic
1184897628 22:47420763-47420785 CAGGTTGAGAACAAGGACCCAGG - Intergenic
949466702 3:4352017-4352039 GTGGTTAAGAACATGGGCTCTGG - Intronic
950037480 3:9897524-9897546 CAGATCAAGAACAGAGGCTCAGG - Intergenic
951323468 3:21274987-21275009 ATGGTTAAGAGCATGGACTCTGG + Intergenic
954208351 3:49077610-49077632 CTGGTTAAAAGCATGGACTCTGG + Intronic
955054422 3:55443270-55443292 CAGTTTAAGAAAAGGGACTCTGG - Intergenic
955605339 3:60695710-60695732 CTGGGTAAGAACAGGGACGCTGG + Intronic
956167172 3:66405659-66405681 CATGTCCAGAAAAGGGACTCTGG - Intronic
956186050 3:66562886-66562908 CAGGAAAACAACAGGGAGTCAGG + Intergenic
956333402 3:68136530-68136552 CAGGTAAAGAACAGTCACTACGG - Intronic
956969144 3:74501732-74501754 CAGGTAAAGATCAGAGACTAAGG - Intronic
958411370 3:93820683-93820705 CTGGCTAAGAGCATGGACTCTGG - Intergenic
958932370 3:100221351-100221373 CAGGCTAACCACAGGGAGTCAGG - Intergenic
959183893 3:103018909-103018931 CAGATGAGGAACAGGGACACTGG + Intergenic
959342953 3:105154336-105154358 TTGATTAAGAACATGGACTCTGG - Intergenic
959482511 3:106890508-106890530 CTGGTGAAGAGCAGGGACTCGGG - Intergenic
960273061 3:115695634-115695656 CTGGTTGAGAACACAGACTCAGG - Intronic
960406480 3:117266459-117266481 GAGATTAAGAACACGGGCTCTGG + Intergenic
960573636 3:119208508-119208530 GTGGTTAAGAACATGAACTCTGG + Intergenic
962303756 3:134267686-134267708 ATGGTTAAGAACATGGGCTCAGG - Intergenic
962402219 3:135070253-135070275 TAGGTTATGGAGAGGGACTCTGG + Intronic
962863556 3:139426938-139426960 AAAGTTAATAACATGGACTCAGG + Intergenic
963513561 3:146279198-146279220 GAGGGTAAGAAAATGGACTCTGG + Intergenic
965972942 3:174585820-174585842 CTGGTTAAGAGCACAGACTCTGG + Intronic
966424519 3:179766792-179766814 AAGGTTAAGAACAAGGATTCTGG - Intronic
967360224 3:188622198-188622220 CAGGTTAAGATGAGTGACACTGG - Intronic
968197179 3:196716650-196716672 GTGGTTAAGAACAGTGACTCTGG - Intronic
968731768 4:2272435-2272457 CTGGTTAGGCACAGGGAGTCTGG - Intronic
968801078 4:2743606-2743628 CAGGGTGTGAACAGGGACCCTGG - Intronic
968976981 4:3827293-3827315 CAGGTGAGGGACAGGGGCTCGGG - Intergenic
969069423 4:4523130-4523152 ATGGTTAAGAGCATGGACTCTGG - Intronic
970035797 4:11734617-11734639 CAGATTAAAAACTGGGATTCAGG + Intergenic
971411467 4:26377334-26377356 CAGGCTAAGTGCATGGACTCAGG - Intronic
972641091 4:40925480-40925502 GTGGTTAAGAGCATGGACTCTGG - Intronic
972692665 4:41414897-41414919 GTGGTTAGGAACACGGACTCTGG + Intronic
973331313 4:48912731-48912753 GAGGTTAAGAACATGAGCTCTGG - Intergenic
973733876 4:53850913-53850935 GAGGTTAAAAATATGGACTCTGG + Intronic
975505996 4:75138312-75138334 GATGTTAAGAACAGGGGCTCTGG + Intergenic
976271005 4:83230261-83230283 CAGGTTCAGACTAGGGTCTCAGG - Intergenic
976579287 4:86716339-86716361 CTGGTTATGAGCACGGACTCTGG - Intronic
976825401 4:89255143-89255165 GTGTTTAAGAACATGGACTCTGG + Intronic
977080666 4:92523707-92523729 CAGGTTCAGCAGAGGGACGCAGG + Intronic
977804553 4:101281297-101281319 CTGGATAAGAACATGGGCTCAGG + Intronic
979128165 4:117003525-117003547 TTGGTTAAGAACAGGGACTCTGG - Intergenic
979226551 4:118292366-118292388 CAGATTTAGAGCAGGGGCTCAGG + Intronic
981132396 4:141172307-141172329 CATGTAGAGAAAAGGGACTCTGG - Intronic
981314446 4:143328178-143328200 CAGGTTAAGATAAAGGACTGTGG + Intergenic
982599413 4:157427428-157427450 CATGTTAATAACAGGGAAACTGG - Intergenic
984665476 4:182422958-182422980 AAGGTTAGGAACAAGGCCTCTGG - Intronic
986329327 5:6705925-6705947 TTTGTTAAGAACAGGGACTGTGG - Intergenic
986854678 5:11854798-11854820 CAGGTAAAGAACTGAGTCTCAGG - Intronic
987227431 5:15857481-15857503 CAAGTGAAGAGCATGGACTCTGG - Intronic
988662909 5:33293050-33293072 CAGGTTAAGAAAAGGGAGACAGG + Intergenic
988716619 5:33835185-33835207 GAGGTTATGAACTGGGGCTCTGG - Intronic
988925693 5:35989587-35989609 CCATGTAAGAACAGGGACTCAGG + Intronic
990044370 5:51411093-51411115 AAGGTTAAGAGCATGGAGTCAGG + Intergenic
990186245 5:53212914-53212936 CAGGTTAAGATCAAGGATTGTGG + Intergenic
991164213 5:63543131-63543153 GTGGTTAAGCACAGAGACTCTGG - Intergenic
995805960 5:116052562-116052584 GAGGTTAAGAACAGAGACCCAGG - Intronic
996307913 5:122071370-122071392 GTAGTTAAGAACAGGGACTCTGG - Intronic
996799834 5:127390816-127390838 GTGGTTTAGAACACGGACTCTGG + Intronic
998480234 5:142457121-142457143 AAGGTTAAGAACACAGGCTCTGG - Intergenic
998968732 5:147568495-147568517 AACGTTAAGAGCAGGGACTTTGG + Intergenic
999473368 5:151875836-151875858 TAGGCCAAGAACAGGGCCTCAGG + Intronic
999686503 5:154107982-154108004 CCGGTAAAGAACATGGAGTCGGG + Intronic
1000495825 5:161983328-161983350 CTGGTTAAGAACACAGGCTCTGG + Intergenic
1000982066 5:167826689-167826711 AAGGTTAAGAGCACAGACTCAGG + Intronic
1001876850 5:175208996-175209018 GTGGTTAAGAGCATGGACTCTGG + Intergenic
1001931310 5:175675013-175675035 GAGGCCGAGAACAGGGACTCTGG + Intronic
1003195135 6:3907650-3907672 CAGGTTAAGATAAAGGACTGTGG - Intergenic
1003871864 6:10410355-10410377 AAGGTAAAGAACAAGGAATCAGG + Intronic
1003944977 6:11066782-11066804 GAGGTTGAGAACATGAACTCTGG - Intergenic
1005819996 6:29590280-29590302 AAGGTTAAGAGCAAGGAGTCTGG - Intronic
1006942216 6:37760087-37760109 AAGGTTCAGAACAGGGACCAAGG + Intergenic
1007311428 6:40949311-40949333 CAGGTTAAGATAAAGGACTGTGG - Intergenic
1007563060 6:42826529-42826551 GAGGTTAAGAACATGGAGGCTGG - Intronic
1009340160 6:62544161-62544183 CAGGTTAAGAACACAAACCCAGG + Intergenic
1011941332 6:92846939-92846961 AATGTTAAGAACATGGATTCAGG + Intergenic
1014708438 6:124777331-124777353 GTGGTTAAGAACATGGATTCTGG + Intronic
1015299198 6:131633512-131633534 CAGGTTAAGAGCAGGCTCTGTGG + Intronic
1015748545 6:136536935-136536957 AAGGTTCAGAACTAGGACTCTGG - Intronic
1015780903 6:136864518-136864540 GAGGTTAAGAACAGGGCCTTTGG - Intronic
1015839377 6:137460510-137460532 CAGGTTCATAACAAGGCCTCAGG + Intergenic
1019363391 7:617602-617624 TAGGTTAAGAACAGTCACACTGG + Intronic
1019840551 7:3438590-3438612 ATGGTTAAGAACATGGGCTCTGG + Intronic
1020250934 7:6467865-6467887 CAGGGAAAGAAGAGGCACTCAGG + Intronic
1021277410 7:18670670-18670692 AAGGTTGAGAACAGGGACTCTGG - Intronic
1021508798 7:21413267-21413289 CAGGTTAAGAGCAAGGTTTCTGG + Intergenic
1021971803 7:25972295-25972317 GTGGTTAAGAACATGGATTCTGG + Intergenic
1022444439 7:30458099-30458121 CTGGGTAGGAACAGGGACCCAGG + Intronic
1024156450 7:46630280-46630302 GAGGTTAAAAGCAGGGACTTTGG + Intergenic
1024583463 7:50820351-50820373 CAGGCAAAGAACTGGGGCTCAGG - Intergenic
1026368515 7:69674342-69674364 GTGGTTAAGACCAGGGGCTCTGG + Intronic
1026614729 7:71891443-71891465 CTGGTTAAGAGCAGGGACTCTGG + Intronic
1027651715 7:80876405-80876427 ATGATTAAGAACAGAGACTCTGG + Intronic
1028091401 7:86707435-86707457 GTGGTTAAGAACAAAGACTCTGG + Intronic
1029664390 7:101985583-101985605 GAGGTTAAGAGCTTGGACTCCGG + Intronic
1030195694 7:106851374-106851396 ATGGTTAGGAACATGGACTCAGG - Intergenic
1030925237 7:115444121-115444143 TAGGTTAATAATGGGGACTCTGG - Intergenic
1031678981 7:124647181-124647203 GAGGTTAAGACCAAGGACTGTGG + Intergenic
1032556841 7:132845080-132845102 GTGGTTAAGAACATGGACTTTGG + Intronic
1032667713 7:134053508-134053530 ATGGTTAAGATCATGGACTCGGG - Intronic
1034186797 7:149184259-149184281 ATGGTTATGAGCAGGGACTCTGG + Intergenic
1034514170 7:151561072-151561094 CTGGTGAAAAACAGGGACACAGG + Intronic
1034628298 7:152511179-152511201 GAGGTTAGGAGCATGGACTCTGG - Intergenic
1035534221 8:378840-378862 CAGCTGGAAAACAGGGACTCAGG + Intergenic
1037503107 8:19504644-19504666 GAGGTTAAGGACATGGACTCTGG + Intronic
1037946022 8:22990255-22990277 CAGGTTAAGCAAGGGGACTTGGG + Intronic
1038214289 8:25547650-25547672 CAGGTTATGAACAGTGACATGGG - Intergenic
1038296629 8:26297559-26297581 TAGGTTAAGAGCACAGACTCAGG + Intronic
1039359411 8:36859719-36859741 CTGGTTAAGAACATGAATTCTGG + Intronic
1039686286 8:39805288-39805310 CAGGTCAAGAAAAGTGACTAGGG + Intronic
1040816906 8:51518307-51518329 CTCCTTGAGAACAGGGACTCTGG - Intronic
1041398719 8:57418962-57418984 CAGATTAAAAACAGGGAATCTGG - Intergenic
1041977005 8:63810915-63810937 AAGGTGAAGAACAGGGAAGCTGG + Intergenic
1042482139 8:69316083-69316105 ATGATTAAGAACAGGGACTCTGG + Intergenic
1042737366 8:72004429-72004451 AGGGTTAACAACAGGGGCTCTGG + Intronic
1045270573 8:100657686-100657708 CAGGTGAAGATCAGGGTCACGGG + Intronic
1045556785 8:103222120-103222142 CAGGTTAAGAAAAAGGATTGTGG + Intronic
1046951027 8:120019882-120019904 GAGGTTAGGAACAGGAACTTGGG - Intronic
1047252801 8:123193280-123193302 CAGCTTAGGGTCAGGGACTCAGG + Intronic
1047593288 8:126349997-126350019 CTGGTTAAGAGCAAAGACTCTGG - Intergenic
1047845206 8:128798253-128798275 ATGGTTAAGAGCATGGACTCTGG - Intergenic
1048927505 8:139284104-139284126 CTGGGGGAGAACAGGGACTCTGG + Intergenic
1049263548 8:141652857-141652879 CACTTGAAGAACAGGTACTCAGG - Intergenic
1050013796 9:1211723-1211745 CAGGTTAAGGACATGGAGACTGG - Intergenic
1050099471 9:2103063-2103085 CAGGTGAAGAACGGGGGCACTGG - Intronic
1050662779 9:7901567-7901589 CTAGTTAAGAACAGGGACTCTGG - Intergenic
1050874722 9:10619568-10619590 TTGGTTAAGCACAGAGACTCAGG - Intergenic
1051103883 9:13555146-13555168 CAGATTACAAACAGGGACTCAGG + Intergenic
1051374379 9:16388888-16388910 GTGGTGAAGAACAGGGGCTCTGG - Intergenic
1055648531 9:78384127-78384149 CTGGTTAAGAACTTGGACTTGGG - Intergenic
1056464613 9:86841567-86841589 CAAGCTCAGAAGAGGGACTCAGG + Intergenic
1057900780 9:98946322-98946344 ATGGTTAAGAGCAAGGACTCTGG - Intronic
1059015972 9:110516018-110516040 GTGGTAAAGAACATGGACTCTGG - Intronic
1059303771 9:113338012-113338034 CTGGTCAAGAACAGGGCCTCTGG - Intronic
1059475620 9:114544875-114544897 GAGGTTAAGCACAGCGATTCTGG - Intergenic
1059598884 9:115754241-115754263 CTGGTTAAGAACATGAACTATGG + Intergenic
1060582333 9:124760841-124760863 GAGGCAAAGAGCAGGGACTCTGG - Intronic
1060896065 9:127218390-127218412 TAGGTTAAGAGCATGGGCTCTGG + Intronic
1060982335 9:127800592-127800614 GAGGCTAAGAATAAGGACTCTGG + Intronic
1061953838 9:133951341-133951363 CAGGAGTAGAACAGGGACTGTGG + Intronic
1185792330 X:2936889-2936911 CAGGGTTGGAACAGGGACTCTGG + Intronic
1186078696 X:5907647-5907669 CAGGTTAATAGCAGGGCCCCAGG + Intronic
1187036963 X:15550361-15550383 GCAGTTAAGAACAGGGACGCTGG - Intronic
1187338532 X:18401589-18401611 GTGGTTAAGAGCATGGACTCTGG - Intergenic
1187889655 X:23922476-23922498 GTGGTTAAGAACTGGGACTTTGG - Intronic
1188403750 X:29781084-29781106 CAGGTAAAGAACAGTGACAGAGG - Intronic
1188473977 X:30570540-30570562 GAGGTTAAGAACATGAACTTGGG - Intronic
1189362916 X:40366962-40366984 CCGGGAAAGAACAGGGGCTCTGG + Intergenic
1190226180 X:48547235-48547257 ATGGTTAAGAACAAGGACTCTGG - Intronic
1190473335 X:50804638-50804660 CAGATGAAGAACCGAGACTCAGG - Intronic
1190788531 X:53677502-53677524 GCGATTAAGAACATGGACTCTGG - Intronic
1190989794 X:55535646-55535668 CAAGTTAAGAACAAGTACTGTGG + Intergenic
1191012795 X:55778239-55778261 ATGGTTAAGAACAAGGACTCTGG + Intergenic
1192183882 X:68933033-68933055 AAGGTTAAGATCATGGATTCAGG + Intergenic
1192253144 X:69430352-69430374 CAGGTTAAGAACAGAGAATCGGG + Intergenic
1192560456 X:72124646-72124668 GAGGTTAAGAGCATGGGCTCTGG + Intergenic
1194721231 X:97342372-97342394 CTGGTTAAGAACATGGGTTCTGG + Intronic
1195464724 X:105167730-105167752 CAGGGAAAGAACATGGACTTTGG + Intronic
1197961604 X:132012416-132012438 CATGTGAAAAACATGGACTCTGG - Intergenic
1198464498 X:136892669-136892691 CTAGCTAAGAACATGGACTCTGG + Intergenic
1198838330 X:140829127-140829149 GTGGTTAAGAGCAAGGACTCTGG - Intergenic
1199864449 X:151830192-151830214 CAGTTTATGACCAGGGTCTCAGG - Intergenic
1200734441 Y:6779134-6779156 CAGGTTCAGTAGAGGGGCTCAGG - Intergenic
1201280911 Y:12341127-12341149 CAGGGTTGGAACAGGGACTTTGG - Intergenic