ID: 946756166

View in Genome Browser
Species Human (GRCh38)
Location 2:222949964-222949986
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946756163_946756166 11 Left 946756163 2:222949930-222949952 CCTTTTTTATTGTGAGCATACAT No data
Right 946756166 2:222949964-222949986 CTGTGTCAGTACATATATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr