ID: 946759098

View in Genome Browser
Species Human (GRCh38)
Location 2:222975383-222975405
Sequence ATTTGGTGGCTAAATGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946759090_946759098 0 Left 946759090 2:222975360-222975382 CCCCCCCTTTTTTTAAGTCAACA No data
Right 946759098 2:222975383-222975405 ATTTGGTGGCTAAATGAAGATGG No data
946759092_946759098 -2 Left 946759092 2:222975362-222975384 CCCCCTTTTTTTAAGTCAACAAT No data
Right 946759098 2:222975383-222975405 ATTTGGTGGCTAAATGAAGATGG No data
946759089_946759098 1 Left 946759089 2:222975359-222975381 CCCCCCCCTTTTTTTAAGTCAAC No data
Right 946759098 2:222975383-222975405 ATTTGGTGGCTAAATGAAGATGG No data
946759088_946759098 5 Left 946759088 2:222975355-222975377 CCTGCCCCCCCCTTTTTTTAAGT No data
Right 946759098 2:222975383-222975405 ATTTGGTGGCTAAATGAAGATGG No data
946759093_946759098 -3 Left 946759093 2:222975363-222975385 CCCCTTTTTTTAAGTCAACAATT No data
Right 946759098 2:222975383-222975405 ATTTGGTGGCTAAATGAAGATGG No data
946759086_946759098 13 Left 946759086 2:222975347-222975369 CCACCGCACCTGCCCCCCCCTTT No data
Right 946759098 2:222975383-222975405 ATTTGGTGGCTAAATGAAGATGG No data
946759094_946759098 -4 Left 946759094 2:222975364-222975386 CCCTTTTTTTAAGTCAACAATTT No data
Right 946759098 2:222975383-222975405 ATTTGGTGGCTAAATGAAGATGG No data
946759091_946759098 -1 Left 946759091 2:222975361-222975383 CCCCCCTTTTTTTAAGTCAACAA No data
Right 946759098 2:222975383-222975405 ATTTGGTGGCTAAATGAAGATGG No data
946759095_946759098 -5 Left 946759095 2:222975365-222975387 CCTTTTTTTAAGTCAACAATTTG No data
Right 946759098 2:222975383-222975405 ATTTGGTGGCTAAATGAAGATGG No data
946759087_946759098 10 Left 946759087 2:222975350-222975372 CCGCACCTGCCCCCCCCTTTTTT No data
Right 946759098 2:222975383-222975405 ATTTGGTGGCTAAATGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946759098 Original CRISPR ATTTGGTGGCTAAATGAAGA TGG Intergenic
No off target data available for this crispr