ID: 946766310

View in Genome Browser
Species Human (GRCh38)
Location 2:223044340-223044362
Sequence CAGATTTTCATCACAGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946766310_946766317 28 Left 946766310 2:223044340-223044362 CCCTGCCCTGTGATGAAAATCTG No data
Right 946766317 2:223044391-223044413 CTTAAGTAAGAAACCCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946766310 Original CRISPR CAGATTTTCATCACAGGGCA GGG (reversed) Intergenic
No off target data available for this crispr