ID: 946767804

View in Genome Browser
Species Human (GRCh38)
Location 2:223056197-223056219
Sequence TATGAAGAAGAGGCTGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946767804_946767808 20 Left 946767804 2:223056197-223056219 CCTGCGGCAGCCTCTTCTTCATA 0: 1
1: 0
2: 1
3: 14
4: 141
Right 946767808 2:223056240-223056262 TTTTGAATCAAGCAAATGGTAGG 0: 1
1: 1
2: 0
3: 25
4: 217
946767804_946767807 16 Left 946767804 2:223056197-223056219 CCTGCGGCAGCCTCTTCTTCATA 0: 1
1: 0
2: 1
3: 14
4: 141
Right 946767807 2:223056236-223056258 CTGTTTTTGAATCAAGCAAATGG 0: 1
1: 0
2: 1
3: 26
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946767804 Original CRISPR TATGAAGAAGAGGCTGCCGC AGG (reversed) Intronic
900869711 1:5293299-5293321 TTTGAAGAAGAGGCTGCTGTGGG - Intergenic
902367959 1:15989743-15989765 TTTGAAGAAGAGGCTTCCTCAGG - Intergenic
903906942 1:26694453-26694475 GAGGAAGAAAAGGCTGCTGCTGG + Intergenic
906581012 1:46935166-46935188 TATGAAGAAGGGACTGCAGTAGG + Intronic
906602713 1:47143728-47143750 TATGAAGAAGAGACCGCAGTAGG - Intronic
907491045 1:54808962-54808984 CAAGAAGAAGAGGCTGCCAAGGG - Intronic
909635320 1:77811360-77811382 GATGAAGAAGAGGGTGGTGCTGG - Intronic
910469394 1:87535337-87535359 AATGAAGAAGAGGCAACTGCAGG + Intergenic
911742684 1:101404276-101404298 TATAAAGAAGACACTGCAGCTGG - Intergenic
913047704 1:115088667-115088689 TATTTAGCAGAGGCTGCGGCTGG + Intronic
914250645 1:145918931-145918953 TTTAAAGAAGAAGGTGCCGCTGG - Intergenic
915312834 1:155012940-155012962 TATGAGGAACAGGCTTCCTCAGG + Intronic
918046479 1:180944651-180944673 TGTGGAGACGAGGCTGCCACGGG + Intronic
920261836 1:204693615-204693637 CATGAAGAAGAGCCTGTCACTGG + Intergenic
920676941 1:208044629-208044651 GATGAGGAGGAGGCTGCCGCCGG + Exonic
922122550 1:222686968-222686990 GATGAAGAAGAGGGTGGTGCTGG - Exonic
922814740 1:228440427-228440449 TCTGAAGTAGAGGCAGCCTCGGG + Intergenic
923849566 1:237778749-237778771 TATGCAGATGAAGCTGTCGCAGG + Exonic
924708085 1:246514006-246514028 TCTGAAGAAGAGGCTTCCTCAGG + Intergenic
1062800996 10:380226-380248 GACGAAGAAGAGGCTGTCCCTGG + Intronic
1063478285 10:6347829-6347851 TCTGGAGAGGAGGCTGCCCCTGG + Intergenic
1064485471 10:15784305-15784327 TATGATGTAGAGGCTGATGCAGG - Intronic
1065233493 10:23622564-23622586 CAAGAAGATGAGGCTGCCTCTGG + Intergenic
1067243607 10:44517485-44517507 TTTGAAGGAGTGGCTGCCGGAGG - Intergenic
1069596615 10:69676149-69676171 TGTGTAGTAGAGGCTGCCTCAGG + Intergenic
1070953065 10:80446265-80446287 AAAGAAGATGAGGCTGCGGCTGG - Intergenic
1076886521 10:133265310-133265332 TATGGGGCAGAGGCTGCAGCAGG - Intronic
1079067980 11:17314278-17314300 TATGAAGAAGTGTCTGCAGTGGG - Intronic
1089778058 11:120852899-120852921 TATGAAGAAGAGCCTTGGGCAGG + Intronic
1090279115 11:125441115-125441137 CATGAAGGAGACGCTGCTGCTGG + Intergenic
1090844136 11:130516873-130516895 TATGAAGAAGAGCCCCCCTCTGG - Intergenic
1096220441 12:49825704-49825726 TATGAAGGTGAAGCTGCAGCAGG - Intronic
1099252352 12:80271806-80271828 TATGAAGAAGAGGCTTACCCTGG - Exonic
1104471643 12:129034372-129034394 TCTGAAGCAGAGGCTGCCTTGGG + Intergenic
1105715090 13:23055520-23055542 TGTGGTGAAGAGGCTGCCGCCGG + Intergenic
1105892439 13:24691129-24691151 GATGAAGAAAAGGATGCCGATGG - Exonic
1107391786 13:39972539-39972561 TTTAAAGTAGAGGCTGCAGCCGG + Intergenic
1112180644 13:97076177-97076199 AAGGAAGCAGAGGCTGCCACAGG - Intergenic
1116520871 14:45845312-45845334 TTTGAAGAAGAGAGTGCCTCAGG - Intergenic
1119415466 14:74466608-74466630 CATGAACAAGGGGCTGCTGCTGG + Intergenic
1123441488 15:20295128-20295150 TATGGAGCAGTGGCCGCCGCCGG + Intergenic
1125608708 15:40956873-40956895 TGTTAGGAAGAGGCAGCCGCTGG - Intergenic
1125722976 15:41853940-41853962 TCTGGAGAAGAGGCTGAAGCAGG + Intronic
1128714014 15:69893828-69893850 TGTGAAGTGGAGGCTGCCGGCGG - Intergenic
1129293606 15:74587224-74587246 TATGGCTAAGAGGCTGCTGCAGG + Intronic
1129350136 15:74951235-74951257 TATGATGCTGAGGCTGCCACAGG - Intergenic
1136694617 16:32066505-32066527 TTTGACGATGAGGCTGCCCCAGG - Intergenic
1136795119 16:33009769-33009791 TTTGACGATGAGGCTGCCCCAGG - Intergenic
1136874797 16:33844613-33844635 TTTGACGATGAGGCTGCCCCAGG + Intergenic
1140132789 16:72178768-72178790 CATGAAGAAGTGGCTGAGGCAGG - Intergenic
1141554793 16:84829877-84829899 GATGAGGAAGGGGCTGCCGCAGG - Intronic
1203097374 16_KI270728v1_random:1271424-1271446 TTTGACGATGAGGCTGCCCCAGG - Intergenic
1142603476 17:1069093-1069115 TATGAAGATGAGGCAGCAACAGG + Intronic
1143205071 17:5135680-5135702 TCTGAAGAAGAGGCTTCCTCAGG - Intronic
1144494982 17:15740498-15740520 AGTGAAGAAGAGGCTCCCCCAGG - Intronic
1144639234 17:16928371-16928393 GGTGAAGAAGAGGCTTCCTCAGG + Intergenic
1144863395 17:18319792-18319814 TAGGAAGCAGAGGCTGCAGTGGG - Intronic
1144872759 17:18380979-18381001 GACGCAGAAGAGGCTGCAGCAGG + Exonic
1144905274 17:18636177-18636199 AGTGAAGAAGAGGCTCCCCCAGG + Exonic
1146131207 17:30277381-30277403 TATGAAGAAGACATTGCCACTGG + Intronic
1146160804 17:30558670-30558692 TCTGAAGAAGAGACTTCCTCAGG - Exonic
1146843579 17:36170135-36170157 TCTGAAAAAGAGGCTTCCTCAGG + Intronic
1146855886 17:36258073-36258095 TCTGAAAAAGAGGCTTCCTCAGG + Intronic
1146864734 17:36330302-36330324 TCTGAAAAAGAGGCTTCCTCAGG - Intronic
1146871792 17:36381984-36382006 TCTGAAAAAGAGGCTTCCTCAGG + Intronic
1146879153 17:36433066-36433088 TCTGAAAAAGAGGCTTCCTCAGG + Intronic
1146883088 17:36454212-36454234 TCTGAAAAAGAGGCTTCCTCAGG + Intergenic
1147067595 17:37930896-37930918 TCTGAAAAAGAGGCTTCCTCAGG - Intronic
1147074679 17:37982608-37982630 TCTGAAAAAGAGGCTTCCTCAGG + Intronic
1147079124 17:38010451-38010473 TCTGAAAAAGAGGCTTCCTCAGG - Intronic
1147086202 17:38062147-38062169 TCTGAAAAAGAGGCTTCCTCAGG + Intronic
1147095063 17:38134393-38134415 TCTGAAAAAGAGGCTTCCTCAGG - Intergenic
1147102148 17:38186112-38186134 TCTGAAAAAGAGGCTTCCTCAGG + Intergenic
1147431211 17:40371886-40371908 CACTAAGAAGAGGCTACCGCAGG - Intergenic
1149846737 17:60012623-60012645 TCTGAAAAAGAGGCTTCCTCAGG + Intergenic
1150085084 17:62269197-62269219 TCTGAAAAAGAGGCTTCCTCAGG + Intergenic
1150719400 17:67601780-67601802 TAAGAGGAAGAGCCTGCCCCCGG + Intronic
1151748491 17:76024020-76024042 GACGCAGAAGAGGCTGCAGCAGG - Exonic
1153582022 18:6582842-6582864 TCTGAGGCAGAGGCTGCAGCAGG - Intronic
1160765550 19:806036-806058 CATGCAGACGAGGCGGCCGCCGG - Intronic
1160869563 19:1271030-1271052 TCTGAAGGTGAGGCTGCTGCTGG + Exonic
1165309759 19:35022959-35022981 TGGGGAGAAGAGGCTGCAGCAGG - Intronic
1166069860 19:40380746-40380768 TCGGAAGAAGGGGCTGCTGCCGG + Exonic
1167100238 19:47400166-47400188 TAAGAAAAAGAGGCTGGGGCCGG + Intergenic
925167526 2:1727275-1727297 TCTGAAGGAGGGGCAGCCGCTGG - Intronic
926265047 2:11308420-11308442 GATGAAGAAGAGGGTGGTGCTGG + Intronic
929412993 2:41718023-41718045 TATGAAGTAGAGGCAGCAACTGG + Intergenic
932284238 2:70519001-70519023 GAGGATGAAGAGGCTGCAGCAGG + Intronic
933713689 2:85345210-85345232 AAGGAAGGAGAGGCTGGCGCTGG + Intronic
934307948 2:91841626-91841648 TAAGAAGAAGTGGCTCCCACAGG + Intergenic
934526361 2:95054244-95054266 TAGGAAGGAGAAGCTGCCCCTGG - Intergenic
934659149 2:96133917-96133939 TAGGAAGAAGGGGCTGAGGCAGG + Intronic
937104689 2:119299212-119299234 TATGAATAAGAGGCTGCGGCTGG - Intergenic
938101618 2:128501445-128501467 AAGGAAGGAGAGGCTGCCGAGGG - Intergenic
938305219 2:130248670-130248692 GATGAAGAAAAGGGTGCCGGTGG - Intergenic
938995954 2:136677805-136677827 TCTGAAGAAGAGGATGCAGAAGG + Intergenic
940739484 2:157490778-157490800 GATGAAGATGAGGCTGAGGCTGG - Intergenic
941658979 2:168175065-168175087 TATTAAGAGGAGGCTGCAGGAGG - Intronic
942731972 2:179070158-179070180 TGTGAAGAAGAGACTGGAGCAGG + Intergenic
944131184 2:196349064-196349086 GGTGGAGAAGAGGGTGCCGCAGG - Intronic
946767804 2:223056197-223056219 TATGAAGAAGAGGCTGCCGCAGG - Intronic
947205311 2:227655634-227655656 GATGAAGAAGAGTTTGCCCCAGG + Intergenic
948200053 2:236123145-236123167 TAGGAGGCAGAGGCTGCCGTGGG - Intronic
1171458116 20:25283211-25283233 GCTGAAGAAGCTGCTGCCGCTGG + Exonic
1172284290 20:33730378-33730400 TAGGAAGTAGAGGCTGCAGTGGG - Intergenic
1173018956 20:39251198-39251220 TATGAAGAACAGGATGCCCTGGG - Intergenic
1179534167 21:42040541-42040563 TTTGAAGAGGTGGCTGCAGCTGG - Intergenic
1182234384 22:28864058-28864080 CATGAAGGAGAGGCTGCAGTGGG + Intergenic
1184512097 22:44939830-44939852 GATGAATAAGAGGCTGCCCACGG + Intronic
1184911667 22:47539457-47539479 AATGAACGAGAGGCTGGCGCTGG - Intergenic
950029334 3:9841832-9841854 TGTGAAGAAGAGGAAGCCGATGG - Intronic
954800315 3:53183393-53183415 GTTGAAGAAGAGGCTGGAGCTGG + Intronic
961312137 3:126009376-126009398 TATGAAGAAGGGGCTGCCCGAGG - Intronic
962538246 3:136350710-136350732 TATGAAGAAGAAACTGCAGCTGG + Intronic
963729887 3:148961190-148961212 TATGAAGAGGAGGGTGGCCCAGG - Intergenic
964303490 3:155315391-155315413 TATGTTGAAGAAGCTGCCCCTGG - Intergenic
965376173 3:167926990-167927012 TAGGAGGAAGAGGGTGCCGGGGG - Intergenic
973218441 4:47698205-47698227 TATGAAGAAGAGAGTACTGCAGG + Intronic
973706165 4:53582898-53582920 TTTGAAGAAGTGGCAGGCGCTGG - Intronic
974538067 4:63195275-63195297 TCTGAAGACGATGCTGCAGCTGG - Intergenic
976281202 4:83328665-83328687 CAGGAAGAACAGGCTGCCGAGGG + Intronic
978016022 4:103747970-103747992 TTTGAAGAAGAGGCTTTGGCTGG - Intergenic
979565796 4:122152694-122152716 TATGAAGGAGTCGCCGCCGCAGG - Intronic
983583126 4:169328811-169328833 TAGGAACAAGAGGCTGAGGCAGG + Intergenic
984819336 4:183866509-183866531 TATGAAGAAGAGGATGGTGGAGG + Intronic
985709318 5:1419469-1419491 TAGGAAGAATAGGCAGCCCCAGG - Intronic
988297994 5:29390826-29390848 GAGGAAGAAGAGACTGCCGGTGG - Intergenic
989783119 5:45294003-45294025 CAGGAAGAAGAGGCAGCCGTAGG - Intronic
991217961 5:64177903-64177925 TATGTAGAAAAGGCTGCCTGGGG + Intronic
997349526 5:133220712-133220734 TATGATGTAGAAGCTGCCCCAGG + Intronic
999157399 5:149468163-149468185 TGTGAAGAGGAGGCTGAGGCAGG + Intergenic
1001073281 5:168605298-168605320 TAAGAAGCAGAGTCTGACGCAGG + Intergenic
1001702284 5:173715709-173715731 AATGAATAAGTGGCTGCTGCAGG - Intergenic
1003865886 6:10362333-10362355 TATAAAGCAGAGGCTGCTGCTGG - Intergenic
1016905989 6:149151386-149151408 TCTGGAGAAGAGGCTGCAGATGG + Intergenic
1020907536 7:14082780-14082802 TATGTAGAAGAAGATGCAGCAGG + Intergenic
1021027771 7:15689084-15689106 TAAGAAGAAGTGGCAGCCTCGGG - Intergenic
1024130094 7:46342412-46342434 TATGAAAAGGAGGCTGCCCAAGG + Intergenic
1024709133 7:51995799-51995821 TATCAGGAAGAAGCTGCAGCTGG + Intergenic
1027171771 7:75877977-75877999 TATGAAGATAAAGCTGCCCCTGG + Intronic
1032239522 7:130149927-130149949 GGTGCAGAAGAGGCAGCCGCAGG + Intergenic
1033228292 7:139577764-139577786 AATGAACAAGAGCCTGGCGCTGG + Intronic
1033440544 7:141374151-141374173 TATGAAGAAGGAGCTGCTCCTGG - Intronic
1033704877 7:143876723-143876745 TATGCAGATGAGGCTGACACTGG + Intronic
1035120936 7:156566258-156566280 TAGGAAGAAGAGGCTGCCTTTGG - Intergenic
1039507442 8:38062077-38062099 TATGAACAAGAGGCAGTGGCTGG + Intergenic
1039618153 8:38973625-38973647 TATGAAGGACTGGCTGCCGCAGG - Exonic
1044949557 8:97422270-97422292 TATGAAAATGAGGCTGGGGCTGG + Intergenic
1046341147 8:112856599-112856621 TATGAAAAAGAGACTGTGGCTGG + Intronic
1047733556 8:127746479-127746501 AATGAAGGAGAGGATGCCGGTGG - Intergenic
1049283066 8:141760389-141760411 TATGAGGCTGAGGCTGCCACAGG + Intergenic
1061779392 9:132986860-132986882 TTGGAAGAAGAGGCTGCTGCAGG - Intronic
1189107842 X:38255817-38255839 TGTAAAGAAGATGCTGCCTCTGG + Intronic
1189365855 X:40387850-40387872 TGTAAAGAAGATGCTGCCTCTGG + Intergenic
1193673370 X:84417424-84417446 CATGAAGGAGAGGCTGATGCAGG - Intronic
1199851000 X:151724879-151724901 GAGGAAGAGGAGGCTGCAGCTGG + Intergenic
1201311043 Y:12598396-12598418 GAGGAAGAAGAGGCTGCTGGTGG + Intergenic