ID: 946770812

View in Genome Browser
Species Human (GRCh38)
Location 2:223086464-223086486
Sequence CACTTTGCAGAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 251}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946770812_946770819 -9 Left 946770812 2:223086464-223086486 CCCAGCTCCATCTCTGCAAAGTG 0: 1
1: 0
2: 4
3: 18
4: 251
Right 946770819 2:223086478-223086500 TGCAAAGTGGATATTGGGAAGGG 0: 1
1: 0
2: 0
3: 22
4: 260
946770812_946770822 26 Left 946770812 2:223086464-223086486 CCCAGCTCCATCTCTGCAAAGTG 0: 1
1: 0
2: 4
3: 18
4: 251
Right 946770822 2:223086513-223086535 CTGATGACTGAGCGACTGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 104
946770812_946770820 -4 Left 946770812 2:223086464-223086486 CCCAGCTCCATCTCTGCAAAGTG 0: 1
1: 0
2: 4
3: 18
4: 251
Right 946770820 2:223086483-223086505 AGTGGATATTGGGAAGGGAAAGG 0: 1
1: 0
2: 1
3: 47
4: 473
946770812_946770818 -10 Left 946770812 2:223086464-223086486 CCCAGCTCCATCTCTGCAAAGTG 0: 1
1: 0
2: 4
3: 18
4: 251
Right 946770818 2:223086477-223086499 CTGCAAAGTGGATATTGGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 204
946770812_946770821 3 Left 946770812 2:223086464-223086486 CCCAGCTCCATCTCTGCAAAGTG 0: 1
1: 0
2: 4
3: 18
4: 251
Right 946770821 2:223086490-223086512 ATTGGGAAGGGAAAGGCAGATGG 0: 1
1: 0
2: 4
3: 103
4: 1225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946770812 Original CRISPR CACTTTGCAGAGATGGAGCT GGG (reversed) Intronic
901351006 1:8596755-8596777 CACTTTGGGGAGTTGGAGATGGG - Intronic
902624694 1:17669848-17669870 CAGTGTGCAGAGACAGAGCTGGG + Intronic
904310736 1:29627997-29628019 GACTGTGCAGAGATGCAGATGGG + Intergenic
904419107 1:30380009-30380031 CACTGTGCACAGCAGGAGCTGGG + Intergenic
906488395 1:46248502-46248524 CCCTTTACAGAGGAGGAGCTTGG + Exonic
906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG + Intergenic
906786469 1:48620184-48620206 GACTTTGCAAAGATGGGGATGGG + Intronic
907592160 1:55685644-55685666 CACTTTGCAGAAAGAAAGCTTGG + Intergenic
907903891 1:58766606-58766628 GACATTGCAGAGATGGAGTGAGG + Intergenic
909661999 1:78094281-78094303 GACTTTGCAGATATTGTGCTAGG + Intronic
913479926 1:119278228-119278250 CACTGTCCTGAGATGGAGGTAGG - Intergenic
915059195 1:153166111-153166133 GACTGGGCAGAGAAGGAGCTAGG - Intergenic
915224448 1:154402268-154402290 CACTTTTTAGATAAGGAGCTAGG - Intergenic
920387029 1:205576494-205576516 CACTTCCCAGAGATGTGGCTTGG - Intronic
920661806 1:207921734-207921756 CACTTTGCAGAAAGTGAGCAGGG - Intergenic
921164127 1:212493981-212494003 CAGTTGGCAGGGATAGAGCTGGG - Intergenic
923126094 1:231035818-231035840 CAGTTTGCAAAAATGGAGCAAGG - Intronic
1063716823 10:8535788-8535810 CCCTTTGCAGCAATGGAGCTAGG - Intergenic
1065961161 10:30735344-30735366 CACATGGCAGACACGGAGCTTGG + Intergenic
1067574261 10:47398383-47398405 CACATTGCAGAAATGGAAGTGGG - Intergenic
1068693789 10:59944326-59944348 CACTGTCAAGGGATGGAGCTTGG + Intergenic
1070445457 10:76496392-76496414 CAGTTTGCTGAGATGGAGCTGGG - Intronic
1070531705 10:77342837-77342859 CACTTCCCAGTGATGGGGCTCGG - Intronic
1070674800 10:78405202-78405224 CACATTGCACAGATGAAACTCGG + Intergenic
1073127403 10:101159907-101159929 CACTTGGCAGAGATGGAGAGTGG - Intergenic
1073726188 10:106233883-106233905 CAATTTACAGAGATTGAACTGGG + Intergenic
1074650887 10:115523214-115523236 CACTTTCTAGAGATGGGGCATGG + Intronic
1075221037 10:120584788-120584810 GACTTTGCTGAGAAGCAGCTTGG + Intronic
1075326689 10:121538348-121538370 CACTTTACACAGATGACGCTTGG + Intronic
1077597730 11:3548257-3548279 CAGTTGGGATAGATGGAGCTGGG - Intergenic
1078619441 11:12893664-12893686 CCCTCTGTAGAGATGGTGCTGGG + Intronic
1080573668 11:33579094-33579116 CACTTTCTAGTTATGGAGCTTGG + Intronic
1080638559 11:34144668-34144690 CACTCTGCAGATAAGAAGCTTGG - Intronic
1081428095 11:42947308-42947330 AGCTAAGCAGAGATGGAGCTGGG - Intergenic
1081444143 11:43113864-43113886 CACTTGGGAGAGAAGGAGCGAGG - Intergenic
1081524601 11:43917673-43917695 TGCTTTTCTGAGATGGAGCTGGG + Intronic
1081821414 11:45999346-45999368 TACTTTGCAGAAATGGAGTAAGG + Intronic
1081885327 11:46490673-46490695 CTTTTTGCAGGGATGAAGCTTGG - Intronic
1081941491 11:46946132-46946154 TACTTTGGAGAAATGGAGGTAGG - Intronic
1083363528 11:62127952-62127974 CTCTTTGTAGAGATGAGGCTAGG + Intronic
1085005601 11:73086160-73086182 CACTTTTGAGAGATAGAGGTGGG + Intronic
1085437878 11:76525238-76525260 CTCTTTCCAGAGATGGTGCTGGG + Intronic
1089124854 11:116169685-116169707 AGCTTTGCAGAGATGGAGAGGGG - Intergenic
1089330558 11:117686166-117686188 CTATGTGGAGAGATGGAGCTGGG + Intronic
1089651763 11:119919174-119919196 CACTATGCAGAGGTGGGGATAGG + Intergenic
1091323411 11:134667181-134667203 CACATGGCAGAGAGGGAGCCTGG - Intergenic
1091368223 11:135039183-135039205 ACCTTTGCGGAGGTGGAGCTGGG - Intergenic
1092109112 12:5946210-5946232 CACTTTATAGAGAAGGAGCCTGG + Intronic
1092156769 12:6287638-6287660 TTTTTTGTAGAGATGGAGCTTGG - Intergenic
1092961527 12:13601030-13601052 CACTTTGAAAGGATGGGGCTGGG + Intronic
1093245358 12:16729835-16729857 CACTCTACAGAGATGGGGCCAGG + Intergenic
1093775461 12:23068584-23068606 CACTTTGCAGAGAAGGAGATTGG + Intergenic
1102019901 12:109675103-109675125 CTCTGTGCAGAGAAGAAGCTGGG + Intergenic
1102539057 12:113605327-113605349 CTTTTTGCAGAGATGGGGCGGGG + Intergenic
1104341912 12:127958244-127958266 CACTTTGCTGAGATGACCCTAGG + Intergenic
1104357622 12:128101634-128101656 GACCATGCAGAGATGGAGCCAGG - Intergenic
1104621819 12:130319500-130319522 AACTTTGCGGAGTTGGGGCTGGG + Intergenic
1104772950 12:131375715-131375737 GACTCTGCAGAGATGGTGCCAGG - Intergenic
1105951681 13:25234814-25234836 CCCATTGCAGAGCTGGAACTAGG + Intergenic
1106448829 13:29861563-29861585 CACTCTGAAGAGAAGAAGCTTGG - Intergenic
1106689470 13:32098420-32098442 CACCTAGCAGGGATGGTGCTCGG + Intronic
1109694728 13:65939314-65939336 GACTTAGCAGAAATTGAGCTGGG + Intergenic
1112718655 13:102216336-102216358 CACTTTGAGGAAATGGAGTTTGG - Intronic
1113553260 13:111209862-111209884 CTCTTTGCAGACATCGGGCTGGG + Exonic
1114458246 14:22871339-22871361 CAGTTTGCAGAGAAGGGGCGGGG + Intergenic
1115304292 14:31917957-31917979 CACTATGCTGACATGGATCTCGG - Intergenic
1115365755 14:32555244-32555266 CACTTGCTAGAGATGGAGCTGGG + Intronic
1115545946 14:34464816-34464838 CACCTGGCAGACATGGTGCTAGG - Intergenic
1116403456 14:44538655-44538677 CACTTTGTAGATATGAAGATTGG + Intergenic
1117692120 14:58318604-58318626 CATTTTGCAGAGAGTGAGGTAGG + Exonic
1117823092 14:59671810-59671832 CACTCTACAGAGCTGGACCTGGG + Intronic
1119736550 14:76986246-76986268 CACTTTGCAGGGATGCAGCCTGG + Intergenic
1119783919 14:77298292-77298314 CACCCTCCAGAGATGGAGCCTGG - Intronic
1120189445 14:81427272-81427294 CACTTTGCAGAGGTGGGTCCTGG - Intronic
1121555388 14:94832477-94832499 CAGGTTCCAGAGATGGGGCTTGG + Intergenic
1122007432 14:98717004-98717026 CACTTGGCAGAGAGGGAGGCGGG + Intronic
1124426551 15:29568104-29568126 CACTTTGCAGAAATGATGATTGG - Intronic
1125482447 15:40089884-40089906 TGCTTTGCAGAGAAGGAGCCGGG - Exonic
1126105000 15:45141662-45141684 CATTCGGCTGAGATGGAGCTCGG + Intronic
1126289358 15:47056223-47056245 CTGTTTACAGAGATGTAGCTAGG + Intergenic
1127723815 15:61728171-61728193 CCCTCTTCAGAGATGGAGCTTGG + Intergenic
1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG + Intronic
1128245006 15:66127109-66127131 CACTTTACAGAGGTGGAAGTAGG + Intronic
1128609068 15:69059400-69059422 GACTTCACAGAGATGGAGCCTGG - Intronic
1129243668 15:74267188-74267210 CATTTTGCAGACATGGGACTGGG + Intronic
1129488314 15:75899012-75899034 CACTTTGGGGAGGTGGAGGTGGG + Intronic
1129726575 15:77904564-77904586 CACATTGTAGAGCAGGAGCTGGG - Intergenic
1130411639 15:83653555-83653577 GACTTTGCAGAGCTGGCGCCCGG + Intergenic
1131146449 15:90016778-90016800 CCCTTTGCAGAGATGGGTCTAGG - Intronic
1132056296 15:98651866-98651888 CACATTTCAGAGATGGAGGGAGG - Intronic
1134799149 16:17068575-17068597 GACTTGGCAGAAATGGAACTTGG - Intergenic
1134827497 16:17296323-17296345 AAGATTGCAGAGATGGGGCTGGG + Intronic
1134837717 16:17376039-17376061 CACTTTACAGAGAAGGAAGTGGG + Intronic
1135012855 16:18898885-18898907 TACTTTTCAGTGCTGGAGCTGGG - Intronic
1135319778 16:21486480-21486502 TACTTTTCAGTGCTGGAGCTGGG - Intergenic
1135372614 16:21917966-21917988 TACTTTTCAGTGCTGGAGCTGGG - Intergenic
1135439171 16:22452735-22452757 TACTTTTCAGTGCTGGAGCTGGG + Intergenic
1136330005 16:29568176-29568198 TACTTTTCAGTGCTGGAGCTGGG - Intergenic
1136444634 16:30307880-30307902 TACTTTTCAGTGCTGGAGCTGGG - Intergenic
1137614003 16:49836315-49836337 CACTTGGGAGAGAAGCAGCTTGG - Intronic
1138806113 16:60090674-60090696 CACTCTCTAGAGAGGGAGCTTGG + Intergenic
1140645611 16:77026697-77026719 CACTTTTGAGAGATTGAGGTTGG - Intergenic
1141829819 16:86503996-86504018 CACTTAGCACAGATGGGACTGGG - Intergenic
1141892594 16:86936545-86936567 CACTTGTAAGAGGTGGAGCTAGG - Intergenic
1143030572 17:3964784-3964806 CACTTCGCAGAATTCGAGCTGGG - Intergenic
1143377882 17:6478095-6478117 CACCTGGAAGAGATGCAGCTGGG + Exonic
1143538679 17:7557214-7557236 CACCTGGCAGAGGCGGAGCTGGG - Exonic
1144831341 17:18132882-18132904 CACTTTGCAGGGATGTAGTGAGG + Intronic
1146008637 17:29177969-29177991 CACCCTGCTGAGGTGGAGCTGGG - Intronic
1147252968 17:39164812-39164834 CACTTGGCAGGCCTGGAGCTGGG + Intronic
1148633222 17:49128243-49128265 CACTTTCCAGAGAGGGAGAATGG + Intergenic
1149871970 17:60191063-60191085 CATTTTACAGACAAGGAGCTAGG - Intronic
1150628666 17:66860273-66860295 CACTTTACAGATAAGGAGGTTGG - Intronic
1151472128 17:74325235-74325257 CACTTTCCAGGGAAGGGGCTGGG - Intergenic
1151783244 17:76261664-76261686 CGCACTGCAGAGATGGAGGTTGG + Intergenic
1152511937 17:80795894-80795916 CACTTCCCAGAGCTGCAGCTTGG + Intronic
1153423915 18:4941854-4941876 AACTTGGCAGAGATGGAGCCAGG - Intergenic
1156070557 18:33202051-33202073 CACCTTGCAGAGGTAGAGTTTGG - Intronic
1158321446 18:56268536-56268558 TTCTTTGAAGAGATGGAGCTGGG - Intergenic
1161842732 19:6692799-6692821 CCCTTTGCAAAGATTGGGCTGGG - Intronic
1161948131 19:7451659-7451681 CACTTTGGAGAGACCGAGGTGGG - Intronic
1164639583 19:29813966-29813988 CACTTTGCAGAGCAGCAGCCAGG + Intronic
1165535427 19:36440296-36440318 CACTTGGCAGAGACTGAGGTAGG + Intergenic
1166657559 19:44623341-44623363 CACATAGCAGAGAGGGAGCTGGG + Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
927555652 2:24029646-24029668 CAGTTTACCAAGATGGAGCTGGG - Exonic
927684788 2:25162791-25162813 CTTAGTGCAGAGATGGAGCTGGG - Intronic
933346177 2:81088479-81088501 GACTGTAGAGAGATGGAGCTGGG + Intergenic
933782554 2:85812415-85812437 CACTTGGCAGAGCTGGAACTGGG - Intergenic
934524529 2:95043439-95043461 CCATTTGCAGAGAGGAAGCTGGG + Intronic
934989386 2:98910799-98910821 CACTTTGCAGAAAAGGAAATGGG - Intronic
935205734 2:100895366-100895388 CACTTTGCAGTTGGGGAGCTAGG + Intronic
940072818 2:149708656-149708678 CACATAGCAGAGAAGGAGGTGGG + Intergenic
941200166 2:162498547-162498569 CCCATTGCAGAGATGAAGATAGG - Intronic
941300583 2:163796062-163796084 AATTTTGAAGAGATGGAGCCAGG - Intergenic
942322014 2:174744012-174744034 CACTTTGCATAGAAGGAGAATGG + Intergenic
944282067 2:197909557-197909579 GACTTTGCAGAGATGAATCAAGG + Intronic
945002981 2:205371485-205371507 CACTGTGCTGACATGGAACTAGG + Intronic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
947441994 2:230131534-230131556 CACCATGCAGAGAGGGAGCAAGG - Intergenic
948601987 2:239112518-239112540 CTCTCTGATGAGATGGAGCTGGG + Intronic
948947091 2:241226216-241226238 CACCAAGCAGAGATGGAACTGGG + Intergenic
1168770104 20:408979-409001 CTCTGTGCTGAGATGGGGCTAGG + Intronic
1168969437 20:1920895-1920917 CATTTTACAGACAAGGAGCTGGG + Intronic
1169027701 20:2384358-2384380 CACTTTCCAGAGAAGGAAATCGG + Intronic
1170253319 20:14311187-14311209 CACTTACCACAAATGGAGCTTGG - Intronic
1170817494 20:19727090-19727112 CACTCTGCAGAGATGGAAGCAGG + Intergenic
1171092196 20:22295916-22295938 CAGCTAGCAGAGGTGGAGCTGGG + Intergenic
1172099742 20:32477990-32478012 CAGTTATCAGAGCTGGAGCTAGG - Intronic
1172299610 20:33839777-33839799 CCCTTTGCAGATAGGCAGCTTGG + Intronic
1173060342 20:39654355-39654377 CACTTTCAAGAGCTAGAGCTGGG + Intergenic
1173458890 20:43225835-43225857 GAATTGGCAGAGGTGGAGCTTGG + Intergenic
1174414214 20:50356554-50356576 CAGCTGGCAGAGGTGGAGCTGGG + Intergenic
1174553270 20:51376469-51376491 CCCTCTGTAAAGATGGAGCTGGG - Intergenic
1176033340 20:63024388-63024410 CACTCTGCAGTGCGGGAGCTGGG + Intergenic
1177336901 21:19740531-19740553 CACCTTGAAGTGATGAAGCTAGG + Intergenic
1178466991 21:32858159-32858181 CAATTTCCAGAGATGGCACTGGG + Intergenic
1178671752 21:34596794-34596816 CACTGTGGAGTGAAGGAGCTCGG + Intronic
1179962340 21:44775276-44775298 CACCTTGCAGAGGTGGTGGTTGG - Intronic
1181992416 22:26847459-26847481 CTCTTTGCAGACATGGCACTGGG + Intergenic
1183552469 22:38498670-38498692 CACTTTGGAGAGATGAAGCTGGG - Intronic
1184022140 22:41827916-41827938 GACTTAGCAGAGAAGGTGCTTGG + Intergenic
1184161653 22:42700742-42700764 CACTTTGGAGGGATGGAGGGAGG + Intronic
1184629325 22:45763477-45763499 CACTCTGCAGACCTGGGGCTGGG - Intronic
1184854691 22:47140032-47140054 CACTTTGGAGATGTGTAGCTAGG + Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
1185173596 22:49306971-49306993 CTCTGTGCAGAGCTGGAGCCGGG - Intergenic
1185203345 22:49522004-49522026 CTCCTTGCAGTCATGGAGCTGGG - Intronic
950191517 3:10979966-10979988 CATTTTGCAGAGATGGGGTGGGG + Intergenic
950486111 3:13274823-13274845 TGCTTTGCAGAGAAGGAACTTGG + Intergenic
952321393 3:32281067-32281089 CCCCATGCAGAGATGGGGCTTGG - Intronic
952902452 3:38119255-38119277 CACTTTGGACAGATTGAGTTTGG - Intronic
953957083 3:47240022-47240044 GACTTGGGAGAGATGGAGCAGGG - Intronic
954698049 3:52437895-52437917 CACTTCGCAGGGGTGGAGCCGGG + Intronic
956933264 3:74070580-74070602 CACTGTGCAGACCTGGGGCTTGG - Intergenic
957501862 3:81067549-81067571 CACTTTCCAGAGAAGGAGAATGG - Intergenic
957520938 3:81317392-81317414 CATTTGGCAGAGAGGGAGTTGGG + Intergenic
961993372 3:131215752-131215774 CTCTTTGCAGAGGTGGGGATTGG + Intronic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
963319383 3:143797023-143797045 AACTTGGCAGAGATGAAGGTAGG + Intronic
964082465 3:152776163-152776185 CTCTCTGAAGAAATGGAGCTGGG + Intergenic
964981264 3:162684198-162684220 CACTTTGTGGAGGTGGAGCAAGG + Intergenic
966857999 3:184209191-184209213 CACTTTGCAATGAAGGAGCCTGG + Intronic
967233277 3:187361127-187361149 CAATTTCCAGAGGTGGACCTGGG + Intergenic
967327606 3:188257795-188257817 CACTTTGCAAATAAGGAACTGGG + Intronic
967830093 3:193911346-193911368 GACTTGGCAGCGTTGGAGCTGGG + Intergenic
967894197 3:194383657-194383679 CATTTTGCAGAAATGCACCTTGG - Intergenic
967953760 3:194861120-194861142 CACTTTGTGAAGAGGGAGCTGGG - Intergenic
968513398 4:1005032-1005054 CAGTTTACAGAGATGGAGGCAGG + Intergenic
969241914 4:5904535-5904557 CATTTTACAGATAAGGAGCTGGG + Intronic
969467372 4:7365818-7365840 CACTTTGCAAAGAAGGTGCCTGG - Intronic
970565012 4:17323468-17323490 CATTTTGCTGTGATGGAGCAGGG - Intergenic
972540228 4:40032596-40032618 TATTTTGTAGAGAAGGAGCTTGG + Intergenic
972602556 4:40585981-40586003 TACTTTATAGAGAAGGAGCTTGG - Intronic
974017017 4:56656655-56656677 CATTTTACAGAGATGGAGATAGG + Intronic
974792095 4:66705285-66705307 CATTTGGCACAGAAGGAGCTGGG - Intergenic
975213541 4:71728706-71728728 AACTGGGCAGAGATGGGGCTGGG - Intergenic
975573785 4:75843252-75843274 CAATTTGAAGGGATGGAGCTGGG + Intergenic
975733806 4:77362891-77362913 GTCTTTGCTGAGATGGAGTTTGG + Intronic
975738198 4:77402512-77402534 AACTTTGCAGAGATGGGGATAGG + Intronic
978161458 4:105553000-105553022 AACGTAGCAGAAATGGAGCTGGG - Intronic
979745747 4:124211003-124211025 CACATTGAAGAGATGGAGAAAGG + Intergenic
980977838 4:139628188-139628210 CACTTAGGAGGGATGTAGCTTGG - Intergenic
982089426 4:151867558-151867580 AATGTTGCACAGATGGAGCTGGG + Intergenic
984021509 4:174489241-174489263 CACTTTGAAAACATGGATCTAGG + Intergenic
986486541 5:8243716-8243738 CCCTTTGGAGAGATGTAGCAGGG - Intergenic
987294144 5:16535456-16535478 GCCTTTGCAGAGTGGGAGCTGGG + Intronic
992371761 5:76151167-76151189 GGACTTGCAGAGATGGAGCTGGG + Intronic
995903301 5:117094198-117094220 CACACTGCAGGGAAGGAGCTGGG - Intergenic
996389711 5:122946870-122946892 CACTGTGCAGGGCAGGAGCTGGG + Intronic
996912025 5:128667325-128667347 TACTTTGCAGAACTGGAGCAAGG - Intronic
997628436 5:135347649-135347671 CACTTTGTAGTGGTGGAGTTGGG - Intronic
997665412 5:135626284-135626306 CACTTTGCAGAAAAACAGCTGGG - Intergenic
997891093 5:137677627-137677649 CACTTTCCAGAGGTGATGCTAGG - Exonic
998345483 5:141458390-141458412 CCCCTTGCAGAGACGGAGCGGGG + Intronic
1002095057 5:176825728-176825750 CATTTTGCTGCCATGGAGCTGGG - Intronic
1002439260 5:179255910-179255932 CCCTTTGCACAGATGCTGCTGGG + Intronic
1002856087 6:1039463-1039485 CACTTTGCCGACTTGGAGCCAGG + Intergenic
1003136919 6:3441059-3441081 CACTGGGCAGAGAAGGTGCTTGG + Intronic
1005099688 6:22157399-22157421 CATTTTGCAGATAAGGAGATTGG + Intergenic
1005460321 6:26063019-26063041 CATTTTACAGAGAAGGAACTTGG - Intergenic
1006934773 6:37709810-37709832 CACTGTGGGGAGCTGGAGCTCGG - Intergenic
1007507683 6:42348923-42348945 GACTTTGCAGTGGTGGAGCTGGG - Intronic
1007617443 6:43188593-43188615 CACTGTGCAGATATCCAGCTTGG + Exonic
1007993832 6:46285288-46285310 CTATTTCCAGAGATGGAGCCTGG + Intronic
1010903388 6:81455424-81455446 CACTTTGCCTATATGAAGCTTGG - Intergenic
1011837345 6:91449942-91449964 TACTTTGCACAGAAGGAACTCGG + Intergenic
1012418328 6:99034341-99034363 CAGTTTGCAAAGATGTGGCTCGG - Intergenic
1012703772 6:102495958-102495980 CAAATGGCAGAGATAGAGCTTGG - Intergenic
1013079961 6:106803534-106803556 CACTTTCCAGAAATTGTGCTTGG + Intergenic
1015937580 6:138418617-138418639 CACTGTGCAGACATGGCGGTTGG - Exonic
1017100003 6:150840158-150840180 CTCTGTGCAGAGATGCAGCGTGG + Exonic
1017137515 6:151161374-151161396 CACTTTGGAGAGAAGGAACAGGG - Intergenic
1021793275 7:24227755-24227777 CATTTTACAGAAATGGAGATGGG + Intergenic
1022860525 7:34362294-34362316 CACTCTACAGAGATGGAGGGTGG - Intergenic
1025256268 7:57385658-57385680 CAGCTGGCAGAGGTGGAGCTGGG - Intergenic
1028348951 7:89819534-89819556 CTATTGGGAGAGATGGAGCTGGG - Intergenic
1030789687 7:113708290-113708312 CACTCTGCAGATATGCAGCTGGG + Intergenic
1030969702 7:116040749-116040771 CAAATGGCAGAGATGGGGCTGGG - Intronic
1033470087 7:141639296-141639318 GACTTTGAAGAGAAGGAGATAGG + Intronic
1034559468 7:151870840-151870862 ACGTTTGCAGAGATGGGGCTGGG - Intronic
1034893975 7:154863534-154863556 TATTTTGTAGAGATGGAGTTGGG + Intronic
1035659047 8:1333198-1333220 CACATTACAGAGATGGAGGAAGG + Intergenic
1038577742 8:28719488-28719510 CACTTTGCACAGAAGGAAGTAGG - Intronic
1039948739 8:42152163-42152185 CACTTTGGTGAAATGGAGCGTGG - Intergenic
1041517864 8:58721946-58721968 CACTTTGGAGATATGCAGCAGGG + Intergenic
1043415083 8:80039659-80039681 CACATTGCAGAGTTTGAACTTGG - Intronic
1044963979 8:97557282-97557304 CATTTTACAGAGATGGCCCTTGG - Intergenic
1045847247 8:106652237-106652259 CAATTTGCTGAGAGTGAGCTTGG + Intronic
1047825256 8:128566191-128566213 TACTTTTCAGAGAAGGATCTGGG + Intergenic
1048110729 8:131465377-131465399 CATTTTGTAGAGATGGGGTTTGG - Intergenic
1048874012 8:138822555-138822577 AACCTTGCAGAGATGGAACAAGG - Intronic
1049202922 8:141350639-141350661 CACTCTGCTGAGATGGAGTGGGG - Intergenic
1049756183 8:144312198-144312220 CACTTTTCAGGGGTGGAGGTGGG - Exonic
1050265146 9:3882105-3882127 CATTTGGCAGACATGAAGCTAGG + Intronic
1050726158 9:8651573-8651595 TATTTTACAGAGATGTAGCTGGG - Intronic
1051001402 9:12286992-12287014 CAATTTCCAGTGATGGAGCGAGG - Intergenic
1055501879 9:76909433-76909455 AATGTTCCAGAGATGGAGCTTGG - Intergenic
1058117002 9:101095741-101095763 CAATATGCAGAGAAAGAGCTTGG - Intronic
1059870701 9:118570929-118570951 ATTTTTGCAGAGATGGAGCCTGG - Intergenic
1062065209 9:134523077-134523099 CACGCTGCAGAGAGGGAGCCGGG - Intergenic
1062438317 9:136556910-136556932 CCCTTTGAGGAGATGGACCTGGG - Intergenic
1190339388 X:49284929-49284951 CCCTTTCAAAAGATGGAGCTAGG + Intronic
1192522741 X:71815994-71816016 CTCTTTCCAGAGCTGGAGTTTGG - Intergenic
1194139915 X:90196591-90196613 CCCTTAGCAGAGATCGAGCACGG - Intergenic
1195135730 X:101906215-101906237 CACTGTGCAGGCCTGGAGCTTGG - Intronic
1195802328 X:108726836-108726858 CACTTGGCACAGAAGCAGCTGGG - Intronic
1195992238 X:110694087-110694109 GTCTTTGCAGGGCTGGAGCTGGG - Intronic
1196199352 X:112867965-112867987 CAGTGTTAAGAGATGGAGCTAGG + Intergenic
1198400416 X:136263196-136263218 GAATTGGCAGAGATGGAGGTGGG - Intergenic
1199071838 X:143485952-143485974 CACTATGCAAAGATGTATCTGGG + Intergenic
1199850715 X:151723368-151723390 AACTTTGCAAAGCTGGGGCTGGG - Intergenic
1200485661 Y:3765560-3765582 CCCTTAGCAGAGATCGAGCACGG - Intergenic
1202237226 Y:22725349-22725371 CACTTTCCAGAGAGGGAGAATGG - Intergenic