ID: 946773338

View in Genome Browser
Species Human (GRCh38)
Location 2:223111933-223111955
Sequence AGCCCAACTCTGATCCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946773338_946773341 0 Left 946773338 2:223111933-223111955 CCTGTCAGGATCAGAGTTGGGCT 0: 1
1: 0
2: 0
3: 15
4: 115
Right 946773341 2:223111956-223111978 GGAGCTACCTGGAATTAAATTGG 0: 1
1: 0
2: 3
3: 3
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946773338 Original CRISPR AGCCCAACTCTGATCCTGAC AGG (reversed) Intronic
903268364 1:22172389-22172411 AACCCAAGTCTGAACCTGCCAGG - Intergenic
905952057 1:41960113-41960135 GGCCCAACTTTCATCCTGAGGGG - Intronic
907353000 1:53848892-53848914 AGCTCAACTCAGCTCTTGACAGG - Intergenic
909423918 1:75499379-75499401 ATGCCACCTCTGATCTTGACAGG + Intronic
910235725 1:85034323-85034345 TCCCCACCTCTGATCCTGGCAGG + Intronic
911663667 1:100531204-100531226 ACCCCACACCTGATCCTGACAGG - Intergenic
916581478 1:166113312-166113334 ATCCCAACTCTGTTCCTTGCAGG + Intronic
918208264 1:182328640-182328662 CAGCCACCTCTGATCCTGACCGG + Intergenic
923671019 1:236041421-236041443 AAACCAACTCTGAAACTGACGGG + Intronic
1064811469 10:19204367-19204389 AGCCCAACTTTCAGCCAGACAGG + Exonic
1066443696 10:35462527-35462549 AGCCTTACTCTGAACCTAACAGG + Intronic
1070864886 10:79702356-79702378 GTCCCAACTCTGAACCTGAATGG - Intergenic
1070878675 10:79840488-79840510 GTCCCAACTCTGAACCTGAATGG - Intergenic
1070920548 10:80182888-80182910 AGCTCAATTCTGACCCTAACTGG - Intronic
1071631780 10:87224577-87224599 GTCCCAACTCTGAACCTGAATGG - Intergenic
1071645234 10:87356798-87356820 GTCCCAACTCTGAACCTGAATGG - Intergenic
1072669957 10:97422087-97422109 TGCCCAACTCTGACCCCGGCAGG + Intronic
1076302621 10:129439500-129439522 AGCCCCACTCTGTTCTTCACTGG - Intergenic
1076595504 10:131622584-131622606 ACCCCAACTCTGACCCTCCCAGG + Intergenic
1077019788 11:412293-412315 TGCCCAACTCTGACCATGTCTGG + Intronic
1077881161 11:6351474-6351496 AGCCCAACTTTCATCCTTCCGGG - Intergenic
1079383889 11:19961888-19961910 AGACCAACTCTGATCCAGCCAGG - Intronic
1081299336 11:41431414-41431436 AGCCATATTCTGAGCCTGACTGG + Intronic
1083144384 11:60748073-60748095 ATCCCAGCTCTGATGCTAACTGG + Intergenic
1084912832 11:72405021-72405043 ATCCTAACTATGATCCTGATGGG + Intronic
1084932829 11:72570766-72570788 ATCCCAACACTCATCCTGCCAGG + Intergenic
1087749952 11:101996357-101996379 ATCCTTTCTCTGATCCTGACTGG + Intronic
1090996254 11:131868454-131868476 AGCCCAGCTCTGATTGTGTCGGG + Intronic
1092761071 12:11811826-11811848 ATCCCAGCTCTGTTCCTGACTGG - Intronic
1094324075 12:29217628-29217650 AACCCAACTCAGTTCCTGATTGG + Intronic
1101711973 12:107275966-107275988 AGCCTAATTCTGATTCTGTCTGG - Intergenic
1101735981 12:107463567-107463589 AGCCCAGCTCTGTTGCTTACTGG - Intronic
1102215073 12:111155170-111155192 ATCCCAGCTCTGTTCCTTACTGG + Intronic
1110339349 13:74370841-74370863 AGTCCAACTCTGAGTCTGAAAGG + Intergenic
1113930396 13:113965219-113965241 AGCCCAACTGTGCCACTGACTGG + Intergenic
1115577711 14:34727167-34727189 TCCCCAAATCTCATCCTGACAGG + Intergenic
1119524503 14:75311477-75311499 AGCCCGACTCTGTGCCTGAATGG + Intergenic
1121303689 14:92891621-92891643 AGCCCCACCCTGATCCAGCCAGG - Intergenic
1121439524 14:93939935-93939957 AGCCCAGCTCTGCCCCTTACTGG - Intronic
1121626410 14:95388663-95388685 ATCCCAACTCTGCTCCTAAGTGG - Intergenic
1122150675 14:99724557-99724579 ACCCCACCTCTGCTCCTGGCTGG + Intronic
1124514492 15:30354907-30354929 AGCTCAACTCTGACACTAACTGG - Intergenic
1124728428 15:32175858-32175880 AGCTCAACTCTGACACTAACTGG + Intergenic
1127481411 15:59380945-59380967 GGCCCAAGTCAGATCGTGACAGG - Intronic
1132142951 15:99409840-99409862 AGCCCACCTCTGTTCCTGATGGG - Intergenic
1135053391 16:19210898-19210920 AGCCCAGCTCTCCTCCTGACAGG - Intronic
1135185828 16:20314993-20315015 ATCCCAGCTCTGCTACTGACTGG - Intronic
1136571629 16:31101245-31101267 ACCCCAACCCTGAGCATGACGGG + Intergenic
1136999639 16:35217326-35217348 GGCCCATCTCTGAGCATGACTGG + Intergenic
1137003317 16:35250683-35250705 GGCCCAACTCTGAGCATGACTGG - Intergenic
1137017607 16:35393145-35393167 GGCCCAGCTCTGAGCATGACTGG - Intergenic
1137031888 16:35532001-35532023 GGCCCAGCTCTGAGCATGACTGG - Intergenic
1139954761 16:70687820-70687842 GGCCCAGCCCTGGTCCTGACAGG + Exonic
1144387310 17:14760873-14760895 AGCTCAACTCTGCTGCTGACTGG - Intergenic
1145254232 17:21314047-21314069 AGCCCAAGTGTTCTCCTGACTGG - Intronic
1145322370 17:21773915-21773937 AGCCCAAGTGTTCTCCTGACTGG + Intergenic
1154315550 18:13300826-13300848 ACCCCATCTCTGATCATGAGAGG - Intronic
1157121494 18:44915648-44915670 AGCCCTGCTCTGGTCCTGCCTGG - Intronic
1162079387 19:8209364-8209386 AGCCGGACTCTGCTCCTGGCCGG - Exonic
1163132598 19:15284927-15284949 AGCCCAACTCTTACACTGACAGG + Intronic
1163490751 19:17616111-17616133 AGCCCAGCTCTTAACCTGACAGG + Intronic
927482690 2:23466990-23467012 ATCCCAACTCTCCTGCTGACTGG + Intronic
936604157 2:113931865-113931887 AGGTCAGCTCTGATCCTGAGGGG - Intronic
937550688 2:123086591-123086613 TGCCCAAATCTGATGCTGAAAGG + Intergenic
937698929 2:124841266-124841288 AACCAAACTCCGATCCTGAAGGG - Intronic
946773338 2:223111933-223111955 AGCCCAACTCTGATCCTGACAGG - Intronic
947278019 2:228416865-228416887 AGCCCAACTCAGAGACTCACTGG - Intergenic
948421425 2:237862878-237862900 AGCCCCACTCAGATCCAGCCTGG - Intronic
1168984760 20:2038656-2038678 AGCCCAGCTCCAATCCTTACGGG + Intergenic
1169264405 20:4158829-4158851 AGCGCACCTCTGATCCTGGCGGG + Intronic
1171340410 20:24422702-24422724 AACCCAACTCTCCTCCTGTCTGG + Intergenic
1171422123 20:25024459-25024481 TGCCCAGCTGTGACCCTGACTGG + Intronic
1173789840 20:45821248-45821270 ACCCCAGCACTGATCCTGGCTGG + Intergenic
1180611024 22:17098001-17098023 AGCCCAATCCTGAGCCTGACTGG - Intronic
1180934955 22:19619326-19619348 AGCCCAACACAGAGCCTGCCTGG - Intergenic
1181882038 22:25988883-25988905 ATCCCAACTCTGCTGCTCACTGG - Intronic
1183766176 22:39877461-39877483 AGCCCCACACTGAGACTGACAGG + Intronic
1183979791 22:41532760-41532782 AGCCCATCAGTGATGCTGACCGG + Intronic
1184264016 22:43337182-43337204 AGCCCAGCTCTGCTGCTCACTGG - Intronic
1184670075 22:46007718-46007740 AGCCTCACTCTGATCCTTAGAGG - Intergenic
950613720 3:14142223-14142245 AGCACATCTGTGATCCTGAAGGG + Exonic
952497400 3:33928124-33928146 ATCCCCACTCTAATCTTGACAGG - Intergenic
954687295 3:52377805-52377827 AGCCCAACTCTGGCCCTCCCCGG + Intronic
954928186 3:54255946-54255968 ACCCCAACTCTGACACTTACTGG - Intronic
961476944 3:127152962-127152984 AGCCCGACTCTGCTCCTTCCTGG + Intergenic
964260272 3:154827617-154827639 AGGCCAAATCTGATCCTAATGGG + Intergenic
964289256 3:155157483-155157505 AGTCCAAATTTGATGCTGACTGG - Intronic
969335712 4:6508646-6508668 CGCCCAACTCAGATCCTGTCAGG - Intronic
969346476 4:6573747-6573769 AGCCCAGCTGTGAGCCTGGCCGG + Intergenic
969712686 4:8853082-8853104 AGCCAAACACAGATTCTGACTGG + Intronic
973290280 4:48464104-48464126 AGCCCAACTGTCACCCAGACTGG - Intergenic
973655128 4:53039196-53039218 AGCCAAACTCTGATCCCAAATGG - Intronic
976350440 4:84054354-84054376 AGCCCACCTCTGATACTGGAAGG + Intergenic
979497627 4:121401719-121401741 ACCCCAACTCTCATCTTGAATGG + Intergenic
984832872 4:183991916-183991938 AGCCCAGTTCTGCTCCTCACTGG - Intronic
986050438 5:4084917-4084939 AGTCCAGCTTTGATTCTGACAGG + Intergenic
988316390 5:29635094-29635116 AGCCCACAGCTGATCCTGAGGGG + Intergenic
990798719 5:59574525-59574547 AATTCAACTCTGATGCTGACTGG - Intronic
998460835 5:142308885-142308907 AGTCCAACTTTCATCCTGATTGG + Intergenic
1001861336 5:175058277-175058299 ACCCCTACTCTGATGCTTACTGG + Intergenic
1004996946 6:21202879-21202901 AGCCCAGCTCTGAACCAGAATGG + Intronic
1006124772 6:31830431-31830453 AGCCCCACTCTAATCAAGACGGG - Intergenic
1006453409 6:34118449-34118471 AGCCCAGCTCTGATTCTAACTGG + Intronic
1006717109 6:36127662-36127684 ACCCCTACTCTGGGCCTGACTGG - Intergenic
1007468598 6:42073376-42073398 AGCCAAACTCTGCTCCTAAAAGG - Intronic
1007687859 6:43677663-43677685 ATCCCAGCTCTGATACTGGCTGG + Intronic
1018069232 6:160147265-160147287 AGTCCAACTCTGAAACTGCCTGG - Intronic
1018945410 6:168344522-168344544 AGCCCAGCTCTGACACTGCCTGG + Intergenic
1019053268 6:169200952-169200974 AGCCCCACTCTGCTCCTGAGAGG + Intergenic
1020245170 7:6424051-6424073 AGCCCTCTTCTGCTCCTGACTGG - Intronic
1023257089 7:38322859-38322881 ACCATATCTCTGATCCTGACTGG + Intergenic
1029231764 7:99075600-99075622 ATCCCAATTCTGATGCTAACTGG - Intronic
1032516874 7:132512913-132512935 AGCCCAACTCTGATTCTTAAAGG + Intronic
1035756082 8:2034090-2034112 AGCCTCACACTGAGCCTGACTGG + Intergenic
1036029442 8:4951376-4951398 GTCACACCTCTGATCCTGACTGG - Intronic
1037911726 8:22747728-22747750 AGCCTGACTCTGCTCCTGGCCGG + Intronic
1038044187 8:23752395-23752417 AACTCAACCCTGATCCTGCCTGG + Intergenic
1039914695 8:41851357-41851379 AGCCCAACCCTGCTCCCAACAGG + Intronic
1042705622 8:71663273-71663295 AGACCAACTGAGTTCCTGACAGG - Intergenic
1047257576 8:123227192-123227214 AGACCAGCTATGATCATGACAGG - Intronic
1047742504 8:127818089-127818111 AGCCGGACTATGATCCTGCCTGG - Intergenic
1047962304 8:130019400-130019422 AGGCTCACTCTGATCCTGATAGG + Intergenic
1053286529 9:36852840-36852862 GGCCCTGCTCTGTTCCTGACTGG - Intronic
1057439252 9:95070756-95070778 AGCCCAACTCTGAGAGTGGCCGG + Intronic
1057442564 9:95092460-95092482 TGCCCAGCTCTGATCCTGCCTGG + Intergenic
1058268703 9:102941491-102941513 AGTTCAACTCTGATCATAACAGG - Intergenic
1061970931 9:134045115-134045137 AACCCAGCTCAGAGCCTGACAGG + Intronic
1186346382 X:8697309-8697331 AGCCCTATTCTGATTCTCACTGG - Intronic
1189967108 X:46386291-46386313 AGGCCACCTCTGATGGTGACAGG - Intergenic
1190973767 X:55379397-55379419 AGTCCAACACAGACCCTGACAGG - Intergenic
1192150527 X:68709405-68709427 ACCCCAACTCTGACTCTGAAGGG - Intronic