ID: 946779548

View in Genome Browser
Species Human (GRCh38)
Location 2:223178891-223178913
Sequence TATGCTAGTTTGGAGTTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946779544_946779548 7 Left 946779544 2:223178861-223178883 CCAAGAAGAGATGTTTGGTGGAC 0: 1
1: 0
2: 0
3: 16
4: 128
Right 946779548 2:223178891-223178913 TATGCTAGTTTGGAGTTTATAGG 0: 1
1: 1
2: 0
3: 8
4: 144
946779541_946779548 18 Left 946779541 2:223178850-223178872 CCATTAGACATCCAAGAAGAGAT 0: 3
1: 2
2: 11
3: 51
4: 294
Right 946779548 2:223178891-223178913 TATGCTAGTTTGGAGTTTATAGG 0: 1
1: 1
2: 0
3: 8
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946779548 Original CRISPR TATGCTAGTTTGGAGTTTAT AGG Intronic
903825725 1:26144086-26144108 ACTGTTAGTTTGGAGGTTATTGG - Intergenic
905743753 1:40395196-40395218 GATCCTAGTTTGGACTTTGTTGG - Intronic
910909170 1:92215638-92215660 TATACCAGTTTGGAGTTCAGGGG + Intergenic
917728071 1:177846738-177846760 TATTTTAGTTTGGATTTTGTAGG + Intergenic
918454479 1:184694115-184694137 TCTGCTAATATGGAGTCTATAGG + Exonic
920011413 1:202870482-202870504 TATGGAAGTTTGGATTTTTTAGG + Intergenic
921642672 1:217574340-217574362 TTGGGTAGTTTTGAGTTTATTGG - Intronic
921939774 1:220827705-220827727 GATGCTAATGTGGAGGTTATTGG + Intergenic
923071990 1:230574102-230574124 TTTGCTATTTTGGAATTTGTGGG - Intergenic
1065031893 10:21594681-21594703 TATGATAGTGAGGAGTTTCTGGG - Intronic
1065864093 10:29898529-29898551 TCTGCTAGTCTAGAGTTTGTTGG - Intergenic
1067171164 10:43907095-43907117 AATGCTCATTTGAAGTTTATTGG - Intergenic
1067970324 10:50962657-50962679 TATGCTGCTTTAGTGTTTATAGG + Intergenic
1068672974 10:59742766-59742788 TATCCTAGCTTGGAGTGTAGTGG + Intergenic
1072583999 10:96765390-96765412 AATGCTAGATGGGAGTTCATGGG + Intergenic
1077704373 11:4470166-4470188 TAGTCTAGTCTGGAGTTTACAGG + Intergenic
1079794782 11:24787837-24787859 TATGCTAGTCTTGAATTTCTGGG + Intronic
1080909880 11:36585244-36585266 TATGCTAGAGTGGAGTTTTGTGG + Intronic
1086212223 11:84334324-84334346 CATGCAAGTTTGGAGGTTTTAGG + Intronic
1090147074 11:124336674-124336696 TAAGCTAGTATGAAGTTAATGGG - Intergenic
1090679651 11:129040821-129040843 TTTGCTAGTTTTGCATTTATAGG - Intronic
1092841422 12:12545816-12545838 TTGGCTAGATTGTAGTTTATAGG - Intronic
1093065596 12:14654904-14654926 TAAGTTAGGTTGCAGTTTATAGG - Intronic
1095434795 12:42175912-42175934 TATAGAAGTCTGGAGTTTATGGG - Intronic
1096331642 12:50718391-50718413 TATTCTAGTTTGGGGTATACAGG - Intronic
1102385165 12:112502793-112502815 TATGCTAGCTAGGATTATATGGG + Intronic
1102837696 12:116081202-116081224 TAGACTAGTTAGGACTTTATAGG - Intronic
1106861552 13:33914419-33914441 TCTGGTAGTTTGGACTTTTTAGG - Intronic
1107460147 13:40594241-40594263 TATGCTCTTCTGGAGTTTAAGGG + Intronic
1109684764 13:65803757-65803779 AATGCTAGTTTGCACTTTGTGGG - Intergenic
1110286451 13:73755157-73755179 TCTGAGAGTTTGCAGTTTATAGG - Intronic
1111172337 13:84543666-84543688 TTTGCTTTTTTGTAGTTTATAGG + Intergenic
1111875315 13:93886285-93886307 TATCCTAGCTTGGATTTTTTGGG - Intronic
1118921915 14:70157218-70157240 TGTGCCAGTTTGGAGTTGACAGG + Intronic
1119603514 14:75994456-75994478 TTTACTAGTTTGGAGTAGATTGG + Intronic
1119694505 14:76701979-76702001 TAGGCTAGTTTGGACCTTGTTGG - Intergenic
1120887658 14:89464282-89464304 TAAGCTAACTTGGAGTTTAGAGG + Intronic
1121200488 14:92112854-92112876 CATGCGAGTTTGGATTTAATAGG - Intergenic
1122055191 14:99093321-99093343 TATGCTTCTTTGGGGTTTTTGGG + Intergenic
1125993100 15:44129615-44129637 TTTCCTAGTTTGGAGTTAATGGG - Intronic
1129887471 15:79048762-79048784 GATGCCAGTTTGCAGTTTCTAGG + Intronic
1130733377 15:86522624-86522646 TATGATACTTTGGAGCTTAAAGG + Intronic
1132076862 15:98828791-98828813 TTTCCTATTTTGGAGTTTTTGGG + Intronic
1141101392 16:81199980-81200002 TACGCTAGCTTGGTTTTTATTGG - Intergenic
1144063578 17:11604488-11604510 TATGCTAGTTGAGAGTTCAGAGG - Intronic
1148362123 17:47020261-47020283 CATGCTAGTTTGCATTTCATAGG + Intronic
1151446944 17:74172673-74172695 TCTGCTGGTTTGGAGGTTTTAGG + Intergenic
1153480984 18:5545533-5545555 TATGTTGCTATGGAGTTTATGGG + Intronic
1155257478 18:24011468-24011490 TTTGCCACTTTGGTGTTTATTGG - Intronic
1155396897 18:25395767-25395789 TTTGCCAGTTATGAGTTTATTGG + Intergenic
1156061941 18:33088812-33088834 TATGCTTATCTGCAGTTTATTGG + Intronic
1158315394 18:56206838-56206860 TATGCTAATTTGGAGTTTATGGG - Intergenic
1158443918 18:57502212-57502234 TAGGCTAGTCTGGAGTTCCTTGG - Intergenic
1165264477 19:34648189-34648211 CACGCTAGTTTGGAGCTCATGGG + Intronic
1167603568 19:50468026-50468048 TATTCGAGTCTGGAGTTTAGGGG - Intronic
927079999 2:19617762-19617784 TGTGCTAGTTTTGTGTTTATTGG - Intergenic
929703207 2:44183155-44183177 TATAACAGTTTGTAGTTTATGGG + Intronic
930420291 2:51143332-51143354 TATGCCAGTTTGGAGGATATGGG + Intergenic
930952825 2:57164222-57164244 TCTGCTGGTTTGGATTCTATAGG - Intergenic
935396228 2:102612140-102612162 TATTCAGGTTTGGAGTTTAGGGG - Intergenic
938608763 2:132924582-132924604 TATGCCTGTTTGTATTTTATTGG - Intronic
939539207 2:143473032-143473054 CGTTCTAGTTTGGAGTTTAATGG - Intronic
939650121 2:144749640-144749662 TTTGCTTGTTTGGTGTTTAGTGG - Intergenic
940033506 2:149289202-149289224 TGTGCTAGATTGGAGTTAGTGGG + Intergenic
941587021 2:167372779-167372801 TTTTCTAGTTTTCAGTTTATAGG - Intergenic
941648274 2:168065468-168065490 TATGATCGTTTGGAAATTATTGG - Intronic
942115320 2:172723073-172723095 TAAGCTAGTAAGGAGTTCATCGG - Intergenic
944204949 2:197148445-197148467 TATGTTAGTTTCAAGTTTCTTGG + Intronic
944928291 2:204488517-204488539 TTTGATAATTTGGAGTTTGTTGG + Intergenic
945504627 2:210623862-210623884 TATGCTTGATTGAAGTTTCTGGG + Intronic
946779548 2:223178891-223178913 TATGCTAGTTTGGAGTTTATAGG + Intronic
947167601 2:227278175-227278197 TAATTTATTTTGGAGTTTATGGG - Intronic
1169037531 20:2465796-2465818 TCTGCTTGTTTGGAGTTCTTTGG + Exonic
1170650801 20:18239260-18239282 TGTGCTAGTTTTGTGTTGATTGG - Intergenic
1171821779 20:29853719-29853741 TATGCTACTGTGTAGTTTTTAGG - Intergenic
1173367084 20:42396027-42396049 TATGCCAGTCTGGAGTTCAGGGG - Intronic
1177639881 21:23833051-23833073 TCTTTTAGTTTGGTGTTTATAGG + Intergenic
949093314 3:55564-55586 AATGCTAGTTTGCAGTTTAGGGG - Intergenic
951979948 3:28554350-28554372 TATGATAGTTTGAAGTTTGGTGG + Intergenic
952197368 3:31090095-31090117 TTTGCTATCTTGAAGTTTATAGG + Intergenic
952573381 3:34744675-34744697 TTAGCTATTTTGGGGTTTATAGG + Intergenic
952583579 3:34864537-34864559 TTGGATAGTTGGGAGTTTATGGG + Intergenic
953048718 3:39320721-39320743 TATGATAGTTTGTACTTTCTGGG + Intergenic
956951268 3:74286065-74286087 TATGCTAATTTGGATTTGATAGG + Intronic
959168515 3:102813170-102813192 TATGAAGGTTTGGGGTTTATAGG + Intergenic
962762267 3:138525698-138525720 ACTGCTAATTTGGAGTTTACTGG + Intronic
963357254 3:144224554-144224576 TAAGCTATTTAGGAGTTTAATGG - Intergenic
969106329 4:4809614-4809636 TATGCTAGATCTGAGGTTATAGG - Intergenic
970947837 4:21716080-21716102 TATCCTAATCTGAAGTTTATGGG + Intronic
973238244 4:47929328-47929350 TATGCAAGTCTGGAGTTCAGAGG + Intronic
974225009 4:59029692-59029714 TATGTTGGTTAAGAGTTTATAGG + Intergenic
974269576 4:59633243-59633265 TATGCTATTCTGGAGTCTAGAGG + Intergenic
976017595 4:80576840-80576862 TAGGCTAGATTGGAGTTCTTTGG + Intronic
976465108 4:85358198-85358220 TGTGCTAGTTTTGTGTTTGTTGG + Intergenic
976551136 4:86396511-86396533 TATGCTAGTTTACATTTTTTTGG - Intronic
978643553 4:110900760-110900782 TATGATCTTTTAGAGTTTATTGG + Intergenic
983501606 4:168505989-168506011 TATGCTGGGTTGGAATTCATGGG - Intronic
985073916 4:186193878-186193900 AATGCTAGATTAGAGTTTAGAGG - Intronic
986257977 5:6116901-6116923 TATGCCAGTTTGGAATTGAAAGG + Intergenic
986840113 5:11687123-11687145 GAAGCCAGTTTGGAGGTTATTGG - Intronic
986956851 5:13161391-13161413 TGTGCTTGTTTGCAGTTTTTTGG + Intergenic
988035260 5:25819850-25819872 TAGGCTAGTTTGGAGGTAAAAGG + Intergenic
988373984 5:30409393-30409415 TATGCATATTTGGAGTTGATAGG + Intergenic
989285929 5:39699909-39699931 TATTCAAGTCTGGAGTTTAGTGG + Intergenic
990593638 5:57291908-57291930 TATGTTAGTTTGGGTTTAATGGG - Intergenic
991910301 5:71552960-71552982 TCTCTTAGTTTGGAGTTTTTTGG + Intronic
992817582 5:80460006-80460028 TATGCAAGAGTGGAATTTATGGG + Intronic
992898693 5:81270650-81270672 TGTGCTAGTTTTGTGTTGATTGG - Intergenic
993659805 5:90619540-90619562 TCTGAAAGTTTGGAGTTAATGGG + Intronic
1000263376 5:159611560-159611582 TATAAGAATTTGGAGTTTATAGG - Intergenic
1001151196 5:169228605-169228627 TATGCTTGTTTGGTGCTTTTTGG + Intronic
1010653197 6:78479462-78479484 TTTACTAGTTTGGAGTCAATGGG + Intergenic
1013058970 6:106613185-106613207 TATACTTGTTTGGGGTTTAGTGG + Intronic
1014408374 6:121081343-121081365 TATACTAATTTGGAATTTAATGG + Intronic
1016514159 6:144874976-144874998 TATAATAGTTTAGAATTTATAGG + Intergenic
1017339276 6:153301935-153301957 TCTCTTAGTTTGCAGTTTATAGG + Intergenic
1020609832 7:10381463-10381485 TATTCTTGTTTGTAGATTATAGG + Intergenic
1020826625 7:13036820-13036842 TATGTTATTTGGGTGTTTATTGG + Intergenic
1021276755 7:18661404-18661426 TATGCAAGTTTGGAGCTCAGGGG + Intronic
1023324568 7:39039128-39039150 TCTACTAATTTGTAGTTTATTGG + Intronic
1028269403 7:88769613-88769635 TTTCCTATTTAGGAGTTTATAGG + Intronic
1028529593 7:91824382-91824404 TGTGCTAGTTTTGGGTTTGTTGG + Intronic
1030344815 7:108421038-108421060 TATGCTATTTTGGGGTATGTGGG - Intronic
1032126247 7:129195572-129195594 TATGCTAGATATGAGTTTATAGG + Intronic
1032884395 7:136122541-136122563 TGTGCGATTTTGGAGTTTATGGG + Intergenic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1035142681 7:156778935-156778957 TATGCAAGAATGGAGTTGATAGG - Intronic
1037216253 8:16456066-16456088 TATATTAGCTTGGAGTTTAAGGG - Intronic
1037268176 8:17091846-17091868 TATACTACTTAGGACTTTATGGG + Intronic
1037333570 8:17769264-17769286 CATGCTGGTTTGGAGGTTTTAGG - Intronic
1039732195 8:40292282-40292304 TATGCTATTGTGGAGTTTGATGG + Intergenic
1040039339 8:42900498-42900520 TATACTAGTATGCATTTTATAGG - Intronic
1041150380 8:54926146-54926168 TATGCTGGTTTTGTGTTGATTGG - Intergenic
1046249429 8:111610669-111610691 TATTTTAGTTTTCAGTTTATAGG + Intergenic
1046253882 8:111670775-111670797 GAGGCTAGTTTTGAGTTTTTTGG + Intergenic
1048220166 8:132533825-132533847 TATATGAGTCTGGAGTTTATCGG - Intergenic
1048603874 8:135947449-135947471 TATGCAAGTCTGAAGTTCATAGG + Intergenic
1052068204 9:24049005-24049027 TATGCCTGTTAGGAGTTTACTGG - Intergenic
1057523218 9:95776887-95776909 AATTCTAGATTGGAGGTTATAGG + Intergenic
1058802206 9:108555489-108555511 TATGGAATTTTGGAGATTATAGG - Intergenic
1062079304 9:134612777-134612799 TATCCTAATTTGGATTTGATGGG - Intergenic
1062584056 9:137241121-137241143 TAAGCCAGTTTGGTCTTTATTGG - Intergenic
1185797571 X:2980194-2980216 TATCCTAATCTGTAGTTTATAGG + Intergenic
1186788398 X:12974434-12974456 TAAGGTAATTTGGAGTTTATAGG - Intergenic
1187242897 X:17529844-17529866 TATGACAGTGTGGAGTTCATAGG + Intronic
1189539947 X:41976415-41976437 TATGCTATTTTGCAATATATAGG - Intergenic
1190000403 X:46681004-46681026 TGTGCTAGTTTGTACATTATTGG - Intronic
1190850207 X:54233076-54233098 TATACTGGTTTAGAGTTTCTTGG - Intronic
1191855734 X:65624546-65624568 TCTGCTAGTTTTGTGTTTAGTGG + Intronic
1194095276 X:89631999-89632021 TGTGCTAGTTTTGTGTTGATTGG + Intergenic
1194317204 X:92394085-92394107 ACTGCTAATTTGGAGTATATAGG + Intronic
1199448311 X:147952575-147952597 CATGCTAGTGTGGTGCTTATTGG + Intergenic
1200625377 Y:5507402-5507424 ACTGCTAATTTGGAGTATATAGG + Intronic
1201674350 Y:16562548-16562570 GATGCTTGTGTGTAGTTTATAGG - Intergenic