ID: 946784663

View in Genome Browser
Species Human (GRCh38)
Location 2:223230307-223230329
Sequence TCATTTTTTTGAAACTACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946784663_946784664 -2 Left 946784663 2:223230307-223230329 CCACAGTAGTTTCAAAAAAATGA No data
Right 946784664 2:223230328-223230350 GAGATTACTAGCGAATCTATCGG No data
946784663_946784666 10 Left 946784663 2:223230307-223230329 CCACAGTAGTTTCAAAAAAATGA No data
Right 946784666 2:223230340-223230362 GAATCTATCGGCAGCATCTCGGG No data
946784663_946784667 13 Left 946784663 2:223230307-223230329 CCACAGTAGTTTCAAAAAAATGA No data
Right 946784667 2:223230343-223230365 TCTATCGGCAGCATCTCGGGTGG No data
946784663_946784665 9 Left 946784663 2:223230307-223230329 CCACAGTAGTTTCAAAAAAATGA No data
Right 946784665 2:223230339-223230361 CGAATCTATCGGCAGCATCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946784663 Original CRISPR TCATTTTTTTGAAACTACTG TGG (reversed) Intergenic
No off target data available for this crispr