ID: 946784667

View in Genome Browser
Species Human (GRCh38)
Location 2:223230343-223230365
Sequence TCTATCGGCAGCATCTCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946784663_946784667 13 Left 946784663 2:223230307-223230329 CCACAGTAGTTTCAAAAAAATGA No data
Right 946784667 2:223230343-223230365 TCTATCGGCAGCATCTCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946784667 Original CRISPR TCTATCGGCAGCATCTCGGG TGG Intergenic
No off target data available for this crispr