ID: 946789461

View in Genome Browser
Species Human (GRCh38)
Location 2:223285461-223285483
Sequence CTGCTAACTCAGAAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946789447_946789461 30 Left 946789447 2:223285408-223285430 CCGGGGTCCTGTGCCTGGGAGGG No data
Right 946789461 2:223285461-223285483 CTGCTAACTCAGAAGGGGCAGGG No data
946789450_946789461 23 Left 946789450 2:223285415-223285437 CCTGTGCCTGGGAGGGTGGCTGC No data
Right 946789461 2:223285461-223285483 CTGCTAACTCAGAAGGGGCAGGG No data
946789453_946789461 -7 Left 946789453 2:223285445-223285467 CCCAGGAGCTCTCACCCTGCTAA No data
Right 946789461 2:223285461-223285483 CTGCTAACTCAGAAGGGGCAGGG No data
946789454_946789461 -8 Left 946789454 2:223285446-223285468 CCAGGAGCTCTCACCCTGCTAAC No data
Right 946789461 2:223285461-223285483 CTGCTAACTCAGAAGGGGCAGGG No data
946789451_946789461 17 Left 946789451 2:223285421-223285443 CCTGGGAGGGTGGCTGCAGCTGC No data
Right 946789461 2:223285461-223285483 CTGCTAACTCAGAAGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946789461 Original CRISPR CTGCTAACTCAGAAGGGGCA GGG Intergenic
No off target data available for this crispr