ID: 946790306

View in Genome Browser
Species Human (GRCh38)
Location 2:223293964-223293986
Sequence CCAGCTCATCTCATTGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946790306_946790309 -10 Left 946790306 2:223293964-223293986 CCAATCTCAATGAGATGAGCTGG No data
Right 946790309 2:223293977-223293999 GATGAGCTGGGTACCTCAGCTGG 0: 9
1: 129
2: 446
3: 762
4: 4637
946790306_946790312 30 Left 946790306 2:223293964-223293986 CCAATCTCAATGAGATGAGCTGG No data
Right 946790312 2:223294017-223294039 GCCTTCTGCATTGATCTTGCTGG 0: 46
1: 118
2: 333
3: 635
4: 1073

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946790306 Original CRISPR CCAGCTCATCTCATTGAGAT TGG (reversed) Intergenic
No off target data available for this crispr