ID: 946790918

View in Genome Browser
Species Human (GRCh38)
Location 2:223299731-223299753
Sequence AGTTATCTGCAAATGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946790918_946790920 4 Left 946790918 2:223299731-223299753 CCTGCCATCATTTGCAGATAACT No data
Right 946790920 2:223299758-223299780 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
946790918_946790924 22 Left 946790918 2:223299731-223299753 CCTGCCATCATTTGCAGATAACT No data
Right 946790924 2:223299776-223299798 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
946790918_946790923 16 Left 946790918 2:223299731-223299753 CCTGCCATCATTTGCAGATAACT No data
Right 946790923 2:223299770-223299792 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
946790918_946790922 15 Left 946790918 2:223299731-223299753 CCTGCCATCATTTGCAGATAACT No data
Right 946790922 2:223299769-223299791 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946790918 Original CRISPR AGTTATCTGCAAATGATGGC AGG (reversed) Intergenic
No off target data available for this crispr