ID: 946806078

View in Genome Browser
Species Human (GRCh38)
Location 2:223472531-223472553
Sequence TCTACCACCCCAATTGGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946806078_946806083 5 Left 946806078 2:223472531-223472553 CCTATTCCAATTGGGGTGGTAGA No data
Right 946806083 2:223472559-223472581 CTTTGTTTTCCAGAAGGGGTTGG No data
946806078_946806082 1 Left 946806078 2:223472531-223472553 CCTATTCCAATTGGGGTGGTAGA No data
Right 946806082 2:223472555-223472577 CAATCTTTGTTTTCCAGAAGGGG 0: 4
1: 5
2: 12
3: 37
4: 416
946806078_946806080 -1 Left 946806078 2:223472531-223472553 CCTATTCCAATTGGGGTGGTAGA No data
Right 946806080 2:223472553-223472575 AACAATCTTTGTTTTCCAGAAGG No data
946806078_946806081 0 Left 946806078 2:223472531-223472553 CCTATTCCAATTGGGGTGGTAGA No data
Right 946806081 2:223472554-223472576 ACAATCTTTGTTTTCCAGAAGGG No data
946806078_946806085 28 Left 946806078 2:223472531-223472553 CCTATTCCAATTGGGGTGGTAGA No data
Right 946806085 2:223472582-223472604 TACTTCCACCATCTCAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946806078 Original CRISPR TCTACCACCCCAATTGGAAT AGG (reversed) Intergenic
No off target data available for this crispr