ID: 946806080

View in Genome Browser
Species Human (GRCh38)
Location 2:223472553-223472575
Sequence AACAATCTTTGTTTTCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946806078_946806080 -1 Left 946806078 2:223472531-223472553 CCTATTCCAATTGGGGTGGTAGA No data
Right 946806080 2:223472553-223472575 AACAATCTTTGTTTTCCAGAAGG No data
946806072_946806080 24 Left 946806072 2:223472506-223472528 CCAAGTTGGGTCTATATATTCTT No data
Right 946806080 2:223472553-223472575 AACAATCTTTGTTTTCCAGAAGG No data
946806079_946806080 -7 Left 946806079 2:223472537-223472559 CCAATTGGGGTGGTAGAACAATC No data
Right 946806080 2:223472553-223472575 AACAATCTTTGTTTTCCAGAAGG No data
946806077_946806080 0 Left 946806077 2:223472530-223472552 CCCTATTCCAATTGGGGTGGTAG No data
Right 946806080 2:223472553-223472575 AACAATCTTTGTTTTCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946806080 Original CRISPR AACAATCTTTGTTTTCCAGA AGG Intergenic
No off target data available for this crispr