ID: 946806082

View in Genome Browser
Species Human (GRCh38)
Location 2:223472555-223472577
Sequence CAATCTTTGTTTTCCAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 4, 1: 5, 2: 12, 3: 37, 4: 416}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946806079_946806082 -5 Left 946806079 2:223472537-223472559 CCAATTGGGGTGGTAGAACAATC No data
Right 946806082 2:223472555-223472577 CAATCTTTGTTTTCCAGAAGGGG 0: 4
1: 5
2: 12
3: 37
4: 416
946806077_946806082 2 Left 946806077 2:223472530-223472552 CCCTATTCCAATTGGGGTGGTAG No data
Right 946806082 2:223472555-223472577 CAATCTTTGTTTTCCAGAAGGGG 0: 4
1: 5
2: 12
3: 37
4: 416
946806078_946806082 1 Left 946806078 2:223472531-223472553 CCTATTCCAATTGGGGTGGTAGA No data
Right 946806082 2:223472555-223472577 CAATCTTTGTTTTCCAGAAGGGG 0: 4
1: 5
2: 12
3: 37
4: 416
946806072_946806082 26 Left 946806072 2:223472506-223472528 CCAAGTTGGGTCTATATATTCTT No data
Right 946806082 2:223472555-223472577 CAATCTTTGTTTTCCAGAAGGGG 0: 4
1: 5
2: 12
3: 37
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946806082 Original CRISPR CAATCTTTGTTTTCCAGAAG GGG Intergenic
902254730 1:15180687-15180709 CTGTCTTCGTTTTACAGAAGAGG - Intronic
902565153 1:17306528-17306550 CAGTCCTCGTTTTGCAGAAGGGG - Intergenic
902883862 1:19390922-19390944 CAGTCCTTGTTTTAAAGAAGGGG + Intronic
902915893 1:19639108-19639130 CAATTCCTGTTTTCCAGATGAGG + Intronic
903449699 1:23444530-23444552 GAATCTCCGTTTTCCAGATGAGG - Intronic
903679144 1:25085428-25085450 CAATCATGGCTTTGCAGAAGGGG - Intergenic
904745432 1:32707792-32707814 CACTCAGTGTTTGCCAGAAGAGG - Intergenic
904809243 1:33152727-33152749 CTATCCTTGTTTTACAGATGAGG + Intronic
904917224 1:33978912-33978934 CCATCTCTATTTTACAGAAGAGG + Intronic
905210843 1:36373148-36373170 CCATCTCTGTTTTACAGATGAGG - Intronic
906559791 1:46748082-46748104 CCATCTCTATTTTCCAGATGGGG + Intergenic
907625850 1:56028585-56028607 CATCCTTTTTTTTCCAGATGAGG + Intergenic
907840959 1:58157158-58157180 GAGTCTTTCTTTTCCAGAGGGGG - Intronic
908081418 1:60582917-60582939 TAATCTTTGTCTTTCAAAAGGGG + Intergenic
909911846 1:81268978-81269000 CAATCTTTGTCTTACAGATGAGG - Intergenic
909961166 1:81844578-81844600 CATTCTTTGTCTTGCAGAGGAGG - Intronic
910048069 1:82941256-82941278 GAAACTCTATTTTCCAGAAGAGG + Intergenic
910446979 1:87308846-87308868 TTATCTTTGTTTTGCAGATGAGG - Intergenic
911730120 1:101283811-101283833 AAATCTTAGCTTCCCAGAAGTGG - Intergenic
911886895 1:103313264-103313286 CAGTTTTTGTTTTCCAAAATGGG - Intergenic
912014742 1:105018568-105018590 CATTCTTTGTTTTCCAGGGCTGG - Intergenic
912217163 1:107627551-107627573 CATGCTTTATTTTCCAGAAATGG - Intronic
912637908 1:111315717-111315739 TAATCTTTATTTTACAGATGAGG + Intronic
913495670 1:119426149-119426171 CAATTGATGTTTTCCAAAAGGGG + Intergenic
916463192 1:165047559-165047581 AAGTCTATGTTGTCCAGAAGTGG - Intergenic
916540355 1:165747815-165747837 TAATCTTTATTTTACAGATGAGG - Intronic
917204769 1:172560978-172561000 CAATCTTTGTTTTCTGAAAGAGG + Intronic
917378291 1:174374793-174374815 CATGCTTTGTCTTTCAGAAGTGG + Intronic
917658897 1:177157724-177157746 CAATCTTCCCTTTCCACAAGAGG + Intronic
918305753 1:183244559-183244581 CAAACTTTGTTTGTCACAAGTGG + Exonic
919983225 1:202655581-202655603 CTATCCTTGTTTTCCAGAACAGG + Intronic
920151656 1:203914302-203914324 CAATTTTTTTTTTCCAGAATAGG - Intergenic
921869768 1:220127142-220127164 CAAACTTTGTTTTACAAAACTGG - Intronic
921977533 1:221219095-221219117 CAATCTGTGTATCCCAGAATAGG - Intergenic
922130921 1:222777037-222777059 CAATGTTTGTTTTTCAGTTGGGG + Intergenic
1063417710 10:5887972-5887994 CCATCTTTGTTCTTCAGGAGTGG + Exonic
1063741282 10:8823011-8823033 CAATCTTTGTACTACTGAAGAGG - Intergenic
1064142576 10:12803088-12803110 CAATCTTCAATTTCCAGATGAGG - Intronic
1065960940 10:30733689-30733711 TAATCTAGATTTTCCAGAAGTGG - Intergenic
1068253430 10:54474295-54474317 CAATCCTTGTTTTACAGATGAGG + Intronic
1070283747 10:75069188-75069210 CAATCTTGGTTTGGCAGAGGAGG + Intergenic
1071666389 10:87562937-87562959 CAAACTTACTTTTGCAGAAGGGG - Intergenic
1071941107 10:90592830-90592852 CAATCTTTGTTGTCCTGATAAGG - Intergenic
1072567847 10:96632592-96632614 AAATATTTGTTTTTCACAAGTGG - Intronic
1073891946 10:108112408-108112430 TAACCTTTGTTTTCCAGAAGAGG + Intergenic
1074634512 10:115298181-115298203 CAATCTTTATTTGCCAAAAAAGG - Intronic
1075918087 10:126186909-126186931 CCATCTTTGTTTTATAGATGGGG + Intronic
1076079463 10:127565737-127565759 CAATCTTTTATTACCAGAAGGGG - Intergenic
1076325262 10:129615968-129615990 GAATCTTTGGTTTGCAGATGGGG + Intronic
1078084836 11:8227511-8227533 CAGGCTTTGTTTTACAGATGAGG - Intronic
1078707759 11:13761522-13761544 CAATCCTTGTGTTTCAGATGTGG - Intergenic
1079507788 11:21173620-21173642 CAATCTCTGTCTTCAAGAAGAGG + Intronic
1079545700 11:21629543-21629565 CACTCTCTGTCTTCAAGAAGTGG - Intergenic
1080604142 11:33850292-33850314 CTATCTTAATTTTACAGAAGAGG - Intergenic
1081098558 11:38971139-38971161 CAGTATTGGTTTTTCAGAAGCGG + Intergenic
1081109647 11:39119311-39119333 CTATCTTTGTTTTGGAGATGAGG - Intergenic
1081342849 11:41949034-41949056 CAATCTGTGTTTTGGTGAAGAGG - Intergenic
1081804323 11:45882112-45882134 CAATCCTTGCATTCCAGGAGTGG + Exonic
1082098780 11:48154108-48154130 GAATATTTGTTTTGCAGATGAGG + Intronic
1083907985 11:65686535-65686557 CAATCTCTGTTTTCCAGAAAGGG - Intergenic
1083913761 11:65726844-65726866 CAGCCCTTGTTTTCCAGAAGGGG - Intergenic
1084266839 11:68009354-68009376 ACCTCTTTGTTTTGCAGAAGGGG + Intronic
1084877834 11:72146660-72146682 CATTCTCTGTTTTCCAGGACAGG - Intergenic
1085202393 11:74709425-74709447 CTATTTCTGTTTTCCAGATGAGG - Intronic
1085611975 11:77958652-77958674 CAACATTTCTTTTCTAGAAGTGG + Intronic
1086946287 11:92846956-92846978 TAATCTTTGTTTTATAGATGTGG + Intronic
1087613341 11:100460417-100460439 CAATCTCAGTTTTGCAGATGTGG - Intergenic
1088108377 11:106230497-106230519 CAAATTTAGTTTTGCAGAAGGGG - Intergenic
1088394226 11:109349006-109349028 CAATTTTTCTTTTTTAGAAGTGG + Intergenic
1089838686 11:121394617-121394639 GAATCTCTGTTTCACAGAAGGGG + Intergenic
1091565046 12:1642028-1642050 CTATTTTTGTTTCCCAGAAAAGG + Intronic
1091701678 12:2667433-2667455 CAATCTGCGTTTTCCATGAGTGG - Intronic
1091904358 12:4171219-4171241 CATTCTTTGGCCTCCAGAAGGGG + Intergenic
1092442051 12:8513098-8513120 CAACCTTTGTTTTCGAGTTGAGG - Intronic
1092601380 12:10069971-10069993 AAATCTTTGTTTTTCAACAGTGG - Exonic
1093328527 12:17808626-17808648 CAATCTCTGTGTTCCAGGGGTGG + Intergenic
1094620183 12:32073372-32073394 CAAACTTGGTTTCCCAGAATTGG - Intergenic
1095611731 12:44136820-44136842 CTAGCTTTTTATTCCAGAAGAGG + Intronic
1095875495 12:47076204-47076226 AAACCTTTGTTTTACAGATGAGG + Exonic
1096016554 12:48281292-48281314 ATGTCTTTTTTTTCCAGAAGGGG - Intergenic
1096455930 12:51786468-51786490 CATTTTTTGATTTCCAGGAGGGG - Intronic
1096794323 12:54065557-54065579 CAATCTTTTCTTTTCAGAAGGGG + Intergenic
1097720846 12:63019466-63019488 CTATCTTTGTTTTACAGATGAGG - Intergenic
1098007874 12:66018556-66018578 TGATCTTTGTTTTACAGATGAGG + Intergenic
1098989064 12:77044709-77044731 CAATCTTGGTTTTGGAGACGAGG + Exonic
1099048349 12:77752118-77752140 CAATATTTGGTTTCCATAAAAGG + Intergenic
1100248137 12:92785191-92785213 CACTCTTTGTTGTCCAGGAAAGG - Intronic
1100289952 12:93204240-93204262 CCATCTTAGTTTTACAGATGAGG - Intergenic
1100955344 12:99901901-99901923 GAATCTTTGTTTTACAGATGAGG - Intronic
1102288285 12:111677507-111677529 TTATCTTTGTTTTACAGATGAGG - Intronic
1102581251 12:113889499-113889521 CCATCTTTGTGTTCCAGATGAGG - Intronic
1102736968 12:115170715-115170737 CAATGTTTGTTTTTCAGATGAGG - Intergenic
1102777351 12:115532199-115532221 CAATCACTGTTTTGCAGATGGGG - Intergenic
1103014735 12:117485156-117485178 CATTCTGTGTTTTCTGGAAGGGG - Intronic
1103020606 12:117531008-117531030 CAATCTCTGGTTTTCAGATGTGG - Exonic
1103289130 12:119829511-119829533 AAAGCTTTATTTTCCACAAGAGG - Intronic
1104446593 12:128838922-128838944 CATTCTTTAATTTCTAGAAGTGG - Intergenic
1106265491 13:28105832-28105854 TAATTTTTTTTTTCTAGAAGTGG - Intergenic
1106352706 13:28949110-28949132 CAATCTTTGTTGCACAGAAAGGG + Intronic
1106537613 13:30661554-30661576 CAAGTTTTGTTTTCCAGGAGTGG + Intergenic
1107371837 13:39759318-39759340 CAATTTTTGGTTTTCAAAAGAGG - Intronic
1107676734 13:42805597-42805619 GAACTTTTGCTTTCCAGAAGTGG - Intergenic
1108511436 13:51159478-51159500 TAATCTATGTTTTCCTGAAATGG - Intergenic
1110754418 13:79154844-79154866 AGATGTTTGTTTTCCAGAAAAGG - Intergenic
1111642658 13:90989559-90989581 CTATCTTTATTTATCAGAAGCGG - Intergenic
1112586719 13:100724985-100725007 AACTCTCAGTTTTCCAGAAGAGG + Intergenic
1112621965 13:101062294-101062316 TCATCTTTGTTTTACAGACGAGG - Intronic
1112645227 13:101323815-101323837 CAATATTTGCCTTCCAGAAAAGG - Intronic
1113343916 13:109454857-109454879 AAATACTTTTTTTCCAGAAGAGG + Intergenic
1113413136 13:110107777-110107799 AAACCTTTGTTTTCCATAGGAGG + Intergenic
1113483244 13:110636930-110636952 CAGCCTCTGTTTTACAGAAGAGG - Intronic
1113644766 13:111986427-111986449 CAATCATTTTTTTCCAGCTGTGG + Intergenic
1113812446 13:113150805-113150827 CAACCTTTGATTTCCAGAAACGG - Intergenic
1113969158 13:114175502-114175524 CAAACATTGATTTCCAGAAAAGG - Intergenic
1116183268 14:41563384-41563406 TAATCTATGTTTTACAGATGAGG - Intergenic
1116328914 14:43571167-43571189 CAAAATCTGTTTTCTAGAAGTGG - Intergenic
1116731426 14:48627353-48627375 CCATGTTTGTATTCCTGAAGTGG - Intergenic
1117384971 14:55202253-55202275 AAATCTTTATTTTCCAGATGAGG - Intergenic
1117791459 14:59346183-59346205 CTATCCTTGTTTTACAGATGAGG + Intronic
1118024135 14:61751423-61751445 CAAACTTTGTTTTTTAGATGGGG + Intergenic
1118085566 14:62412051-62412073 CAATCTTTCTTTTCTATAATTGG - Intergenic
1119198019 14:72731929-72731951 CTATCTTTGTTTTTCAGAAGTGG - Exonic
1119787416 14:77323925-77323947 CAACCTTTGTTTTACAAATGAGG + Intronic
1120300277 14:82697713-82697735 CAATCTTTATTTTCCACTATTGG - Intergenic
1120301414 14:82712186-82712208 CAATCTTTATTTTACAGATGAGG + Intergenic
1120328379 14:83056747-83056769 CAGTCCTTGTTTTCCAGAGAGGG - Intergenic
1120497816 14:85258398-85258420 CAATGGTTATTTTTCAGAAGTGG - Intergenic
1121233541 14:92376336-92376358 CACTCTTCCTTTTGCAGAAGAGG - Intronic
1121717719 14:96088229-96088251 ACATCTTAGTTGTCCAGAAGCGG + Exonic
1122678963 14:103441806-103441828 CACACTTTGTTCTTCAGAAGTGG + Intronic
1122733314 14:103818936-103818958 CAATTTTAGTTTTCAATAAGTGG + Intronic
1125180716 15:36878954-36878976 CTTTCTTTGTTTTCCAGCACCGG + Intergenic
1125449468 15:39793151-39793173 CAATCTCTTTTTTGCAGATGGGG - Intergenic
1125716070 15:41820661-41820683 TAATCCTTGTTTTACAGATGAGG - Intronic
1127637976 15:60889287-60889309 CAAGCTTCCTTTTGCAGAAGAGG + Intronic
1127714033 15:61630153-61630175 CTAACTTTATTTTCCAGAACAGG + Intergenic
1127714933 15:61640739-61640761 TAACCATTGTTTTACAGAAGGGG + Intergenic
1128793004 15:70446893-70446915 CCATCCTTGTTTTACAGATGAGG - Intergenic
1128879161 15:71227352-71227374 CAATATGTGTGTCCCAGAAGGGG + Intronic
1129686282 15:77687849-77687871 AAATCTCTTTTTTCCAAAAGAGG + Intronic
1130239105 15:82168930-82168952 CTATCTTTGTATTTGAGAAGAGG + Intronic
1130242877 15:82213168-82213190 CAATCCATTTTTTCCCGAAGTGG + Intronic
1130311867 15:82763292-82763314 CCATCTTAGTTTTCCACCAGGGG - Intronic
1131654022 15:94435198-94435220 CAATCTTTATTTTATAGAAATGG - Intronic
1131847909 15:96507528-96507550 GAATTTTTGGATTCCAGAAGAGG + Intergenic
1134352906 16:13454537-13454559 TCATCTTTGTTTTACAGATGAGG + Intergenic
1134369838 16:13612870-13612892 CCAGCCCTGTTTTCCAGAAGAGG - Intergenic
1134558392 16:15186202-15186224 CAATCATTGTTTTATAGAAATGG + Intergenic
1134918923 16:18097803-18097825 CAATCATTGTTTTATAGAAATGG + Intergenic
1135105705 16:19647304-19647326 CAATCATTTTTGTCCAGATGAGG - Intronic
1137855238 16:51788090-51788112 CTTTCTTTGTTTAACAGAAGAGG - Intergenic
1137962235 16:52894344-52894366 CAATCTGTGTTTTCCACTGGGGG - Intergenic
1138045135 16:53714459-53714481 CCATCTTTGTTTTCAAAAAATGG - Intronic
1138427252 16:56943965-56943987 GAATGCTTGTTTTTCAGAAGAGG + Exonic
1139379357 16:66520845-66520867 CAGTCTTCTTTTTCCAGAAAAGG - Intronic
1140625057 16:76783514-76783536 AAGTCCTTTTTTTCCAGAAGTGG - Intergenic
1140714238 16:77707583-77707605 CTATCTTCATTTTCCAGAAGAGG + Intergenic
1142279250 16:89139173-89139195 CTTTCTTTGTTTTCCAGAGTCGG + Intronic
1143542553 17:7578325-7578347 CCTTCCTTGTTTTCCAGAATCGG + Exonic
1144540099 17:16132973-16132995 CTTTCTTTTTTTTCCAGACGGGG + Intronic
1144696087 17:17304681-17304703 TTATCTCTGTTTTCCAGATGAGG + Intronic
1144930813 17:18857767-18857789 CTATCTTTGTTTTTCAGATGAGG + Intronic
1146115443 17:30133418-30133440 GAATCTTTTTTTTCAAGCAGTGG + Intronic
1146173151 17:30648219-30648241 CAATCTTGGGTTTCCTGGAGCGG - Intergenic
1146346611 17:32064251-32064273 CAATCTTGGGTTTCCTGGAGGGG - Intergenic
1149388008 17:56161123-56161145 CAATCTTTATTTTACAGAGGAGG - Intronic
1149468216 17:56895947-56895969 AAAACTTTCTTTTGCAGAAGAGG - Exonic
1149932288 17:60768726-60768748 CATTCTTTGTGTTCCAGTGGTGG + Intronic
1152200134 17:78940506-78940528 CATTCTGTATTTTTCAGAAGTGG - Intergenic
1154950018 18:21201038-21201060 CAATCTTTAATTTCTAGAAAAGG - Intergenic
1154974542 18:21444304-21444326 AAATCTTTGTTTTCCAACTGTGG - Exonic
1155501614 18:26492233-26492255 CAATTTTTTTTTTCCAGATAGGG - Intronic
1155680686 18:28482328-28482350 CAATCTTTGTTTTCCAAAGGGGG - Intergenic
1157495322 18:48153081-48153103 CCATCTTTGTCTTCCACAAAAGG + Intronic
1158186013 18:54772411-54772433 CATTCTCTTTTCTCCAGAAGAGG - Intronic
1158879159 18:61760156-61760178 CCATTTCTGTTCTCCAGAAGAGG - Intergenic
1158929187 18:62304567-62304589 CAAGCTGTGTTTTACAGATGAGG + Intronic
1159183709 18:64943818-64943840 CAATCTTTGTTTTCTAGAAGAGG + Intergenic
1159183713 18:64943859-64943881 CAATCTTTGTTTTCTAGAAGAGG + Intergenic
1160230206 18:77042733-77042755 CAATGTCTGTTTTTCAGAAACGG + Intronic
1161852040 19:6742613-6742635 TAATTTTTTTTTTCCAGATGAGG - Intronic
1162707031 19:12562808-12562830 TTATCTTCGTTTTACAGAAGGGG - Intronic
1165379968 19:35472260-35472282 CAATCCCCGTTTTACAGAAGAGG + Intergenic
1166065124 19:40353504-40353526 CCATCTCTGTTTTTCAGATGAGG - Intronic
1167114802 19:47483040-47483062 ACCTCTTTATTTTCCAGAAGGGG + Intronic
1167667153 19:50829263-50829285 CAATCTTCATTTTACAGATGAGG - Intronic
1168189402 19:54726883-54726905 CGATTTCTGTTCTCCAGAAGTGG + Intronic
1168643322 19:58044373-58044395 AAAGCTTTGTTTTAAAGAAGCGG + Intronic
925380992 2:3426193-3426215 CATTTTTTCTTTTCCACAAGGGG - Intronic
925405752 2:3604604-3604626 CAACCCTTGATTTCCAGATGGGG - Intronic
925424434 2:3736988-3737010 CAATCTTCCATTTCCAAAAGTGG - Intronic
925723776 2:6853441-6853463 TGATCTGTGTTTTCCAGATGAGG - Intronic
925764390 2:7216844-7216866 CAATCTGCTTTTTCCAGAAGAGG - Intergenic
927948634 2:27152671-27152693 CAATCTGTGTCTTGCAGAAGTGG + Exonic
928250969 2:29679263-29679285 AAATGTATGTTTTCTAGAAGAGG - Intronic
928398617 2:30962240-30962262 CAGTCTCTGTTTTGCAGAAAAGG + Intronic
928888065 2:36172822-36172844 CCATCTTTGTTTCCTCGAAGAGG - Intergenic
929101486 2:38319087-38319109 CATTCTTTATTTTACAGATGGGG + Intronic
929305144 2:40353015-40353037 TTATCTTTGATTTCCTGAAGGGG + Intronic
929667614 2:43845411-43845433 GAATCCTTGTTTTACAGATGAGG - Intronic
929677589 2:43952713-43952735 AGTTCTTTGTTTCCCAGAAGAGG + Intronic
929915670 2:46133425-46133447 CAATCCCTGTTTTCAAGGAGAGG - Intronic
930743868 2:54861042-54861064 CCATTTTTTTTCTCCAGAAGGGG + Intronic
931168512 2:59777234-59777256 CTATCTTTATTTGCCAGAACTGG + Intergenic
931310007 2:61068832-61068854 TTATCTTTGTTTTACAGATGAGG + Exonic
933126122 2:78608377-78608399 CTATCTTAATTTTCCAGACGAGG - Intergenic
933582167 2:84139772-84139794 CACCCTTTGTGTTCCAGAAATGG + Intergenic
935846643 2:107173091-107173113 AAATGCTTGTTTTCCAGATGAGG + Intergenic
935849600 2:107204427-107204449 CAATCTGTGTTTTACTGAATGGG - Intergenic
936635163 2:114247828-114247850 CAGGCTTTGTTTTCTAGAAAAGG + Intergenic
937620186 2:123976409-123976431 AAATCATTGTTTTTCAGAATTGG + Intergenic
937850112 2:126624370-126624392 CCATCCTTATTTTCCAGATGAGG + Intergenic
939968874 2:148638367-148638389 CAAGCTTTGTTTTCTAGCTGTGG - Intergenic
940927583 2:159382415-159382437 TAATATTTGTTTTTCAGATGAGG + Intronic
941937990 2:171001684-171001706 GCATTTTTATTTTCCAGAAGAGG + Intronic
943757438 2:191571268-191571290 CATTCTTGTGTTTCCAGAAGAGG + Intergenic
945944654 2:215983220-215983242 CCATCTGATTTTTCCAGAAGTGG - Intronic
946806082 2:223472555-223472577 CAATCTTTGTTTTCCAGAAGGGG + Intergenic
947952098 2:234157009-234157031 AAATCTTTATTTTCCAGCAATGG + Intergenic
1170139657 20:13112787-13112809 CTATCTTTATTTTACAGATGAGG - Intronic
1170210795 20:13844547-13844569 TAATCCTTGTTTTCCAAAACAGG + Intergenic
1170469461 20:16654173-16654195 CAACCTTTCTCTTCCAGGAGAGG - Intergenic
1172645859 20:36469070-36469092 TCATCCTTGTTTTTCAGAAGAGG + Intronic
1172820531 20:37729420-37729442 AAATGTTTGTTTTAAAGAAGAGG + Intronic
1173380712 20:42538083-42538105 CAATCTTTATCTTACAGATGTGG + Intronic
1173711881 20:45165085-45165107 CCATATTAGTTTTCCAGAAATGG + Intergenic
1174039794 20:47691003-47691025 TAATCCTTATTTTCCAGAACAGG + Intronic
1174951950 20:55051732-55051754 CAATCTTTATTTTACACAGGAGG - Intergenic
1177021062 21:15859019-15859041 CACTGTTTGTTTACCAAAAGTGG + Intronic
1177269505 21:18829013-18829035 CAATCTTTGTTTTCAATAATTGG - Intergenic
1178575551 21:33785788-33785810 CATTTTTTGTTTTCCAAAAAAGG + Intronic
1180034435 21:45236482-45236504 CTGTCTTTGTTTTGCAGAGGAGG - Intergenic
1181388219 22:22559547-22559569 CAAACTCTGTTTTCCTGAAAGGG + Intronic
1181964821 22:26649182-26649204 TAATCTCCGTTTTACAGAAGAGG + Intergenic
1182685341 22:32118826-32118848 CCATCTTTGTTTTAAAGATGAGG - Intergenic
1182936245 22:34224588-34224610 TAATCTCTGTTTTCCAGATATGG + Intergenic
1183600072 22:38835030-38835052 CTATCTCTGTTTTACAGATGAGG - Intronic
1183698553 22:39437040-39437062 TAATTTTTTTTTTGCAGAAGAGG - Intronic
1184080983 22:42220097-42220119 CAATGTTGGTTTTCTATAAGAGG - Intronic
949536001 3:4996706-4996728 CAAACTCAGTTTTCCAGCAGAGG + Intergenic
950003483 3:9676011-9676033 CAGCCCATGTTTTCCAGAAGTGG - Intronic
950114103 3:10439281-10439303 CCTTCTTTATTTTCCAGATGGGG + Intronic
950372619 3:12543919-12543941 TAATCTTTGTTTTACAGATAAGG + Intronic
951212856 3:19994458-19994480 CATTCTTTGTTTTGCAGAGATGG - Intronic
951757413 3:26106357-26106379 CATTCTTTGTTTTCCAGGGCTGG + Intergenic
951833037 3:26951370-26951392 CCATCTTTGTTTTCCAGAAGGGG + Intergenic
951923866 3:27886172-27886194 CTAGCTTTGTTTTCCAGAAATGG - Intergenic
952253945 3:31679723-31679745 CAATTTTTGTTTTTAAGAAAAGG + Intronic
952634558 3:35511856-35511878 CTATTTTTTTTTTCCAGATGTGG - Intergenic
953237102 3:41116632-41116654 CTATTTTTCTTTTCCAGAGGAGG - Intergenic
953458458 3:43062583-43062605 TTATCTTTGTTTTACAGATGAGG + Intergenic
953705469 3:45226634-45226656 CCTCCTTTGTTTTACAGAAGGGG + Intergenic
954789514 3:53121292-53121314 CCATCTTTTTTTTGCAGAATAGG - Intronic
954995696 3:54879561-54879583 CTGCTTTTGTTTTCCAGAAGGGG + Intronic
955547958 3:60051894-60051916 CAATCTTTGTTTCACAGAGTGGG - Intronic
955923237 3:63980474-63980496 CTATCCTCGTTTTCCAGATGAGG + Intronic
956261605 3:67349481-67349503 ATATCCTTGTTTTGCAGAAGAGG - Intergenic
958000881 3:87747426-87747448 GAAACTTTCTTTTTCAGAAGAGG - Intergenic
958595529 3:96217182-96217204 TAATCTTTGTTTTCCATAAGTGG + Intergenic
958705606 3:97650712-97650734 CAATATGTGTTTTAAAGAAGAGG + Intronic
959168017 3:102805128-102805150 TAATCTTTGTTTTACAAATGAGG + Intergenic
959308655 3:104701510-104701532 GACTCTTTGTTTTTCAGAGGAGG + Intergenic
959588965 3:108054343-108054365 AAATCTTTTTTTTTCAGAATGGG - Intronic
959829382 3:110842348-110842370 CAATATTTGTTTAAAAGAAGAGG - Intergenic
961199041 3:125029132-125029154 GAAACTTTGTTTTCCAGGACTGG + Intronic
961975826 3:131024322-131024344 GAATCTTGGTTTACCAGAATGGG - Exonic
961982409 3:131094425-131094447 CAATCTGTGTTTTCCAAGGGGGG + Intronic
962416905 3:135191457-135191479 CCATCATTTTCTTCCAGAAGTGG + Intronic
962685511 3:137843805-137843827 CAAACTTTTTTTTTCAGAATTGG + Intergenic
962956234 3:140269600-140269622 AAAGCTTTTCTTTCCAGAAGGGG - Intronic
963241986 3:143014311-143014333 TTAAGTTTGTTTTCCAGAAGAGG - Exonic
963357615 3:144229719-144229741 CACACTTTTTTTTCCAGAATGGG - Intergenic
964370202 3:155992549-155992571 CAGTCTTTCATTTCCAGAACTGG - Intergenic
964616191 3:158668503-158668525 CAACCTTTTTGTTCTAGAAGAGG + Intronic
964641244 3:158912401-158912423 CAATCTTTGTTTTCCAGAAGGGG + Intergenic
964786708 3:160403370-160403392 TAATGTTTGTTTTCTAGAAATGG + Intronic
964875252 3:161359889-161359911 AAATCTTTATTTTGCAGATGAGG - Exonic
965115554 3:164483316-164483338 TAAACTTTCTATTCCAGAAGGGG - Intergenic
965176407 3:165339927-165339949 CAACCTCTGTTTGCCAGCAGAGG + Intergenic
965603508 3:170477469-170477491 CAATCTCTATTTTACAGATGAGG - Intronic
965986316 3:174757966-174757988 TAACTTTTGTTTTCCAGAAATGG + Intronic
966519320 3:180855581-180855603 TGATCTTTGTTTACCAGGAGGGG - Intronic
966940598 3:184744227-184744249 CCAGCTTTGTCTTCCAGAATTGG + Intergenic
968298615 3:197596380-197596402 CAGTTTTTATTATCCAGAAGTGG + Intergenic
968322415 3:197781367-197781389 CTATTATTGTTTTCCAGAAATGG + Intronic
968695568 4:2024366-2024388 CAACCTTTGTTTTCCAGGACAGG + Intronic
969075972 4:4577957-4577979 CCACCTTCATTTTCCAGAAGGGG - Intergenic
969351551 4:6600855-6600877 TCACCTTTGTTTTACAGAAGAGG + Intronic
969581276 4:8067043-8067065 CTATCCTTGTTTTCCAGAGGAGG + Intronic
970285352 4:14507325-14507347 CACACTTAGTTTTCCAGAAATGG - Intergenic
970316243 4:14831103-14831125 TAATCTCTGTTTTACAGATGAGG - Intergenic
970604932 4:17670712-17670734 CCATCTTTGATTTACAGATGGGG + Intronic
970834287 4:20383090-20383112 CAAGGTTTATTTTCCAGATGTGG - Intronic
970918181 4:21360654-21360676 CAATCTTCTTTTTCCATTAGAGG - Intronic
971172552 4:24248479-24248501 CACTTTTTTTTTTCCAGAGGTGG - Intergenic
971223393 4:24729811-24729833 CCAACTATGTTTTCCAGATGTGG + Intergenic
971498928 4:27298041-27298063 TAATCTTTGTTTTAAAGTAGTGG + Intergenic
972361895 4:38333425-38333447 CAAAATTTCTTTCCCAGAAGCGG + Intergenic
972436915 4:39044270-39044292 TAATCATTGTTTTCCAGTGGTGG - Intergenic
973134611 4:46690778-46690800 TAATTTTTTTTTTCCAGAAAGGG + Intergenic
973707201 4:53592596-53592618 CAACATTTATTTTCCTGAAGGGG - Intronic
973735895 4:53871424-53871446 GCATCTCTGTTTTACAGAAGGGG - Intronic
973877804 4:55238879-55238901 CATTGTTGGTGTTCCAGAAGGGG - Intergenic
973921098 4:55686042-55686064 CAATCTCTGTTCTCCAGAGCAGG - Intergenic
974102328 4:57430743-57430765 CTATCTTTGTTTTATAGATGAGG + Intergenic
974166523 4:58211949-58211971 CACTTTTTGTTGTCCAGAGGTGG - Intergenic
974324300 4:60394118-60394140 CTATCTTTATTTTCCAGGATAGG - Intergenic
974672111 4:65045605-65045627 CAATCTTTGGTTTTCAGTAGTGG + Intergenic
975278505 4:72532307-72532329 AAATCATTGTTTTCCCTAAGGGG - Intronic
975363472 4:73500069-73500091 CAAAGTTTGTTTTACAGCAGTGG - Exonic
975569903 4:75804695-75804717 CTATCTTCATTTTGCAGAAGAGG - Intronic
975776304 4:77790985-77791007 CAATCTTTGTTAGCCAGGTGCGG + Intronic
976074544 4:81282621-81282643 GTTTCTTTGTTTTGCAGAAGTGG + Intergenic
976140261 4:81984145-81984167 CAGTCTTTCTTTCCTAGAAGAGG - Intronic
976146691 4:82048376-82048398 TTATCCTTGTTTTCCAGATGAGG - Intergenic
976370459 4:84282298-84282320 CAATCTCTATTTTTCAGATGAGG + Intergenic
976781900 4:88769461-88769483 CCATCTTCATTTTCCAGATGAGG - Intronic
977117569 4:93050120-93050142 CAATTTTTGTTTTCCAGTAATGG - Intronic
977216282 4:94287688-94287710 CAATCTTTATTTTAAAGCAGTGG - Intronic
977428018 4:96893544-96893566 AAAGCTTTGTTTTAGAGAAGTGG + Intergenic
977500995 4:97836521-97836543 CAATCTTAGTTTTACTGCAGTGG + Intronic
977546033 4:98379000-98379022 AACTCTTTGTTTTACAGATGAGG + Exonic
978468787 4:109038748-109038770 AAATCTTTGCTTCCCATAAGAGG + Intronic
978905480 4:114000775-114000797 CAAGCTTTCATTTCCAAAAGTGG - Intergenic
979515135 4:121599121-121599143 ATCTCTTTGTTTTACAGAAGAGG + Intergenic
979523303 4:121692722-121692744 CTATTTTTGTTTCACAGAAGGGG - Intronic
979655770 4:123191756-123191778 CATTTTTTGTTTTCCATGAGTGG + Intronic
981122833 4:141072290-141072312 CAGTTTCTGTTTTTCAGAAGTGG - Intronic
981868543 4:149458115-149458137 TCATATTTGTTTTCCTGAAGGGG - Intergenic
983130205 4:164009905-164009927 CAATATTTGTTGACTAGAAGTGG - Intronic
984440606 4:179764838-179764860 TTATCTTTCTTTTTCAGAAGTGG - Intergenic
984591364 4:181620886-181620908 CATTTTTTGTTTTCCATAAGTGG - Intergenic
985121883 4:186651689-186651711 CAATCTGTGTTTTGCAGAAGCGG - Intronic
985270511 4:188190257-188190279 CAATCTTTTTTTTTTAGGAGGGG - Intergenic
985380179 4:189385797-189385819 CAAGCTGTGTTTTACAGCAGAGG - Intergenic
985777121 5:1850563-1850585 CAAGCTTTGTGTTCCACAATGGG + Intergenic
986927848 5:12780223-12780245 CAATTAATATTTTCCAGAAGGGG - Intergenic
988420207 5:30996498-30996520 AAACCTATGTTTTCCAGAAAGGG - Intergenic
988599973 5:32630847-32630869 GAAGGTATGTTTTCCAGAAGAGG + Intergenic
989487917 5:42013271-42013293 CAATCTTTCTTTTTGAGATGGGG - Intergenic
989707685 5:44357246-44357268 CAACCTTTCTTTTACAGAGGAGG + Intronic
990148780 5:52792293-52792315 CATTCTTTGTTTTGAATAAGTGG - Intronic
990695093 5:58407576-58407598 CAATCTTTGCTTTGCAGACAAGG + Intergenic
991330961 5:65491355-65491377 CCATCTTTGGTTTCCTGAACAGG - Intergenic
992159212 5:73984212-73984234 CTACCCTTGTTTTCCAGATGAGG + Intergenic
994345429 5:98680030-98680052 CGATCCCTGCTTTCCAGAAGTGG - Intergenic
994455180 5:99996934-99996956 CAAGCTATGTTTTCCAAGAGTGG + Intergenic
994641341 5:102413138-102413160 CAATCTTGTTTTTACAGAACAGG - Exonic
994906566 5:105846625-105846647 CAATATTTGTTTTCGAGAAGGGG - Intergenic
995456136 5:112354098-112354120 CTATCTTTGTTTTGCAGATGAGG - Intronic
996010146 5:118473213-118473235 AAATCTTTGCTTTGAAGAAGAGG + Intergenic
997913601 5:137901402-137901424 CATTTTTTTTTTTCCAGAATAGG - Intronic
999573533 5:152947496-152947518 TAATCTATGTTTTCCTGAACTGG - Intergenic
999932415 5:156447932-156447954 TAATCTCTGTTTTACAGGAGGGG + Intronic
1000463718 5:161550058-161550080 CCTTCTCAGTTTTCCAGAAGAGG - Intronic
1000465664 5:161572977-161572999 CAAGCTGGGTTTCCCAGAAGTGG + Intronic
1000786643 5:165552901-165552923 GAATCTTCGCTTTCCAGAAATGG - Intergenic
1001478568 5:172069220-172069242 AAATCTTTGTTTTTTAGTAGAGG - Intronic
1001636990 5:173217638-173217660 CATTCTTGTTTTTCAAGAAGAGG + Intergenic
1003066487 6:2908326-2908348 TAATCTTGGTTCTACAGAAGAGG + Intergenic
1003302958 6:4901534-4901556 GAATCCTTGTTTTACAGAAGAGG + Intronic
1003514073 6:6804021-6804043 CAATCTTAGTGCCCCAGAAGTGG + Intergenic
1004010529 6:11681683-11681705 AAATCTTTGTCGTACAGAAGGGG + Intergenic
1005099331 6:22153137-22153159 CAAACTTTGTTTACAAAAAGAGG + Intergenic
1005251568 6:23951919-23951941 CAATATCTGTTATCCAGAAATGG + Intergenic
1005288481 6:24354770-24354792 CAACCTTTATTTTACAGCAGAGG - Intronic
1005397112 6:25394345-25394367 TAATTTCTGTTTTACAGAAGAGG + Intronic
1005597799 6:27395847-27395869 CAATCTCTCTTCTCCAGAATGGG + Intronic
1006553208 6:34842475-34842497 CAATTTTTAATTTCCAGAATAGG - Intronic
1006760548 6:36456824-36456846 CCATCTCTTTTTTCCAGACGTGG - Intronic
1006877677 6:37312901-37312923 CACCTTTTGTTTTACAGAAGAGG + Exonic
1008147257 6:47906989-47907011 CCATCTTTGTTTTCCAAAGTAGG + Intronic
1008902527 6:56637745-56637767 AATTCATTGATTTCCAGAAGAGG + Intronic
1009927673 6:70139585-70139607 CAAACTTTCTCTTCCAGAACAGG + Intronic
1010288904 6:74112876-74112898 CACTCTTTGTGCTCCAGAAATGG + Intergenic
1010456773 6:76064733-76064755 TGATCTTTGTTTACCAGGAGAGG - Intronic
1010634668 6:78243099-78243121 TTATTTTTGCTTTCCAGAAGGGG - Intergenic
1011183235 6:84645144-84645166 CAATGTTTGTTTACCAAATGAGG + Intergenic
1012208318 6:96489195-96489217 CAAACTTTGTTTGCCAGATAAGG - Intergenic
1012961290 6:105624778-105624800 ATATCTCTGTTTTCCAGATGAGG + Intergenic
1013101313 6:106989267-106989289 GAAACATTCTTTTCCAGAAGTGG + Intergenic
1013362876 6:109410863-109410885 CACCCTTTGTTTTCTGGAAGGGG - Intronic
1013691426 6:112649264-112649286 CCTTCTTTATTTTCCAGATGAGG - Intergenic
1014592759 6:123293572-123293594 CAATCTTTATTTTTCAGAAGGGG - Intronic
1015060464 6:128958924-128958946 CAATCTTTGTCTTCCATACTAGG - Intronic
1016060458 6:139624461-139624483 CAATCCTTGATTTACAGAGGAGG - Intergenic
1016119366 6:140328181-140328203 CATTCTTTGGGTTCCAGCAGGGG + Intergenic
1016683698 6:146857910-146857932 TCATGTTTGTTTTCCAAAAGGGG + Intergenic
1017760511 6:157564328-157564350 GTCTCTTTCTTTTCCAGAAGTGG + Intronic
1018717428 6:166544300-166544322 CTGTCTTTCTTTTCCGGAAGAGG - Intronic
1019201512 6:170320055-170320077 TTATCCTTGTTTTACAGAAGAGG + Intronic
1020004479 7:4775059-4775081 CGATCTCTGTTTTACAGATGAGG - Intronic
1020352359 7:7234957-7234979 TAATCTTTTTTTTCCTCAAGAGG + Intronic
1020685686 7:11290808-11290830 TAATCTCTGTGTTGCAGAAGTGG + Intergenic
1021030489 7:15727264-15727286 CTTTCTTTGTTTTCCAAAATTGG + Intergenic
1021498988 7:21308402-21308424 GAATGTTTGTTTTCCAGAGGAGG - Intergenic
1021859780 7:24894991-24895013 CTCTCTTTCTTTCCCAGAAGGGG - Intronic
1022220679 7:28310477-28310499 CCATCTCTGTCTTCCAGATGAGG - Intronic
1022633123 7:32104685-32104707 GAATCTTTGTTTACCAGAAGAGG + Intronic
1023403690 7:39809995-39810017 CTATCTTCATTTTACAGAAGAGG + Intergenic
1023411236 7:39891081-39891103 CCATCTTTGTTTCACAGGAGAGG - Intergenic
1024435825 7:49353786-49353808 CAATCTTCATTTTCCAGAAGGGG + Intergenic
1024810242 7:53202546-53202568 CAATATTTTTTTTCCAGATCAGG + Intergenic
1025073669 7:55924040-55924062 AAATCTTTCTTTTCCATGAGAGG + Intronic
1025841113 7:65150413-65150435 CAACATTTCTTTTCTAGAAGTGG - Intergenic
1025881931 7:65545537-65545559 CAACATTTCTTTTCTAGAAGTGG + Intergenic
1025891510 7:65657095-65657117 CAACATTTCTTTTCTAGAAGTGG - Intergenic
1026052917 7:66961851-66961873 CCATCCTTGTTTTACAGATGAGG - Intergenic
1026230924 7:68483398-68483420 CATTCTTTGTCTTGCAGAACTGG - Intergenic
1027937333 7:84625171-84625193 CATACCTTGTTTTCCAGAAAAGG + Intergenic
1028048172 7:86150344-86150366 CACACTTTGTTTTGGAGAAGAGG + Intergenic
1028386268 7:90257086-90257108 TGATCTCTGTTTTCCAGAATAGG - Intronic
1031110313 7:117599573-117599595 CATTATTTCTTTTCCAGAAAAGG - Intronic
1031126498 7:117779288-117779310 GAAAATTTTTTTTCCAGAAGTGG - Intronic
1031152686 7:118073012-118073034 CAATTTTTTTTTTTCAGAAAAGG - Intergenic
1032408529 7:131675380-131675402 AAACCTTTGTTTTCCATAAAAGG - Intergenic
1032579574 7:133091869-133091891 CAATTTTTTTTTTGTAGAAGGGG - Intergenic
1032856789 7:135841669-135841691 CAAACTTTTTTTTACATAAGAGG - Intergenic
1032866183 7:135926629-135926651 CACTCATTTTTTTCTAGAAGTGG + Intergenic
1034762105 7:153682275-153682297 CAATCTTTGATTTCCTGATGAGG + Intergenic
1035517762 8:251003-251025 TAATCTTTGTTTCCCAGAAGTGG + Intergenic
1036386820 8:8289010-8289032 CAATCCTTCATTTCCAGAGGAGG - Intergenic
1036678375 8:10852965-10852987 CAATGTTAAGTTTCCAGAAGAGG - Intergenic
1037666418 8:20973792-20973814 CAGTCATTATTTTCCAGATGAGG + Intergenic
1037671282 8:21017303-21017325 CAAGCTTTCATTTCCAGCAGTGG + Intergenic
1038689990 8:29752603-29752625 CAATCACTGGTTTGCAGAAGCGG - Intergenic
1041062207 8:54045127-54045149 CCATCTTGATTTTACAGAAGAGG - Intergenic
1042189561 8:66171922-66171944 CAATCTCATTTTTCCAGAATTGG - Intronic
1043851050 8:85217187-85217209 CAACATTTGTTTTCAAGAAAGGG + Intronic
1043978800 8:86614616-86614638 CTAACTTTTTTTTCCAGTAGAGG + Intronic
1044205586 8:89489131-89489153 GAATCTTTGTTCTGCAAAAGTGG + Intergenic
1046157493 8:110312159-110312181 GATTCTTTGTTTTCTAGAATGGG + Intergenic
1046668004 8:117026254-117026276 CAATATTTGTCTTCAATAAGGGG + Intronic
1047363779 8:124193635-124193657 AAATATTTGTTTTCCCTAAGTGG + Intergenic
1048371588 8:133783180-133783202 CTGTCTTTCATTTCCAGAAGTGG + Intergenic
1048889300 8:138933573-138933595 CTAGCTTTATTTTCCAGATGAGG - Intergenic
1050607776 9:7319062-7319084 CCTTCTTGGTTTTCTAGAAGTGG - Intergenic
1053126569 9:35585728-35585750 CAATCTTTGTTTTCCAAAAGGGG - Intergenic
1054514680 9:66026397-66026419 GAATTTTTTTTTTCCTGAAGAGG - Intergenic
1054875021 9:70087002-70087024 CTAACTTTTTTTTCCAGATGGGG + Intronic
1054924921 9:70579567-70579589 CTCTGTTAGTTTTCCAGAAGGGG + Intronic
1056109523 9:83381047-83381069 CATTCTTTTTTCCCCAGAAGAGG - Intronic
1056129985 9:83574856-83574878 CAATCTTAGTTTTAGAGATGGGG + Intergenic
1056364520 9:85890209-85890231 CACACTTTGTTTTCCATCAGTGG - Intergenic
1056918523 9:90765005-90765027 CAATCTTTATTTTCCAGAGGTGG + Intergenic
1058329732 9:103744655-103744677 CAATCTCTGTTTTTAAGAAGTGG - Intergenic
1058798768 9:108524194-108524216 AAATCCTTGTTTTGCAGATGGGG - Intergenic
1058891679 9:109366443-109366465 CATTCTTTTTTTTCCAGACAGGG + Intergenic
1059420598 9:114188472-114188494 TCATCCTTGTTTTACAGAAGTGG - Intronic
1059599539 9:115761638-115761660 CTCTCTTTGTCTCCCAGAAGAGG + Intergenic
1059987198 9:119831948-119831970 CTATTTTGGTTTTCCTGAAGAGG + Intergenic
1186373532 X:8971297-8971319 CAATAAATGTTTTCCACAAGGGG + Intergenic
1186402572 X:9273366-9273388 AAATCTTTGTTTACAAGAATAGG - Intergenic
1186988516 X:15042274-15042296 CACTATTTCTTTTCCAGAAATGG + Intergenic
1187121533 X:16412315-16412337 CATTTTTTTTTTTCCAGAATAGG - Intergenic
1187603250 X:20856843-20856865 ACATCTTTGATTTCAAGAAGAGG - Intergenic
1187834081 X:23413098-23413120 CAATCTTTTTTTGCCAGTTGAGG - Intergenic
1188275068 X:28190542-28190564 TAATTTTTGTTTTTCAGTAGAGG + Intergenic
1189173335 X:38930582-38930604 AGAACATTGTTTTCCAGAAGCGG - Intergenic
1189620081 X:42826841-42826863 CAAACTTTATTTCCCAGAAGTGG + Intergenic
1190415182 X:50173927-50173949 CCTTCTGTGTTTTCCTGAAGGGG + Intergenic
1192238262 X:69309892-69309914 CCATCCCTGTTTTCCAGATGAGG - Intergenic
1193326239 X:80181279-80181301 CAATCTTTGTTTTCCAGAAGGGG - Intergenic
1194119886 X:89948590-89948612 CAAAATTTGTTTTCTTGAAGTGG - Intergenic
1194769537 X:97884535-97884557 AAATCTTTGTTTTCTTGAAGAGG - Intergenic
1195277780 X:103299130-103299152 CAATCTTTGTTTTCCAAAAGGGG + Intergenic
1195447628 X:104972112-104972134 CAATCTTTGTTTTCCAGAAGCGG + Intronic
1197966844 X:132072701-132072723 CAATCTTTTGTTTTCAGTAGGGG + Intergenic
1198395670 X:136216628-136216650 ACATCTTTCTATTCCAGAAGTGG + Intronic
1198402875 X:136284702-136284724 AAATCTTTGTTTTCAAAAAGAGG - Intergenic
1198787976 X:140312208-140312230 TAATCTTTTTTTTGCAGAAATGG + Intergenic
1199280610 X:145995635-145995657 CAATATATGTTTTGTAGAAGAGG - Intergenic
1200032125 X:153305326-153305348 CCATCGTGTTTTTCCAGAAGTGG + Intergenic
1201561785 Y:15324900-15324922 TATTCTTTCTTGTCCAGAAGAGG - Intergenic