ID: 946806085

View in Genome Browser
Species Human (GRCh38)
Location 2:223472582-223472604
Sequence TACTTCCACCATCTCAGATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946806079_946806085 22 Left 946806079 2:223472537-223472559 CCAATTGGGGTGGTAGAACAATC No data
Right 946806085 2:223472582-223472604 TACTTCCACCATCTCAGATTAGG No data
946806078_946806085 28 Left 946806078 2:223472531-223472553 CCTATTCCAATTGGGGTGGTAGA No data
Right 946806085 2:223472582-223472604 TACTTCCACCATCTCAGATTAGG No data
946806084_946806085 -9 Left 946806084 2:223472568-223472590 CCAGAAGGGGTTGGTACTTCCAC No data
Right 946806085 2:223472582-223472604 TACTTCCACCATCTCAGATTAGG No data
946806077_946806085 29 Left 946806077 2:223472530-223472552 CCCTATTCCAATTGGGGTGGTAG No data
Right 946806085 2:223472582-223472604 TACTTCCACCATCTCAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946806085 Original CRISPR TACTTCCACCATCTCAGATT AGG Intergenic
No off target data available for this crispr